X
تبلیغات
فعالیت گروه آموزشی علوم زیست

فعالیت گروه آموزشی علوم زیست

نمونه سوال ومطالب علمی

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 11:7  توسط زارع زاده  | 

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 11:7  توسط زارع زاده  | 

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 11:5  توسط زارع زاده  | 

سوالات تست فصل ده زیست شناسی و آزمایشگاه 2

سوالات تست فصل ده زیست شناسی و آزمایشگاه 2

1- غلا ف ساقه جوان كدا م گياه را مي پو شاند ؟

الف- لوبيا                ب- ذرت                            ج- نخود                   د- باقلا

2- دركدام گياه ساقه جوان به صورت مستقيم رشد ميكند؟

الف- لوبيا               ب- ذرت                           ج- نخود                     د- باقلا

3- كداميك از خصو صيات گياهان يكساله نمي باشد؟

الف- در يك فصل رشد حرفه زندگي خود را تكميل و پس از بين مي روند          ب- تمام انها علفي هستند 

ج - مرا حل رشد رويشي وز ايشي انها در دو  دوره رشد است                          د – سرعت رشد أنها ز ياد است

4- كدام يك از گياهان يكساله محسوب نمي شوند؟

الف- لوبيا               ب- هويج                           ج- آفتابگردان                  د- برنج

5- از خصوصيات گيا هان دو ساله كدام است؟

الف- ذخيره مواد غذايي درساقه                                     ب- توليد محور گل درفصل اول رشد

ج- توليد ر يشه و ساقه و برگ در اولين فصل رشد               د- ساقه ها بلند و علفي است

5- كدام گياه دو ساله محسو ب ميشو د؟

 الف- جفر ي                      ب- آفتابگردان                  ج- داودي                      د- زنبق

6- كداميك جزو گياهان هميشه سبز نيستند ؟

الف-كاج                           ب- مركبات                        ج-سرو                         د- نارون

7- در مورد پديده رشد كدام گزينه صحيح نمي باشد؟                                

الف- رشد افز ايش تعداد سلولها پس از  طر يق تقسيم شدن آنهاست     

ب- رشد افزايش غير قابل برگشت ابعاد سلولها ست

ج- آماس سلولها پس از جذ ب آب نوعي رشد است                                                                          

د- پد يده رشد و تما يز اغلب همراه هم هستند

8- كداميك رشد محسوب نمي شود؟

الف- پيدايش برگهاي جد يد                                           ب- تشكيل گل

ج- بو جود آوردن انشعابات ريشه                                      د- بو جود آوردن انشعابات ساقه

9- مريستم نخستين در كدام بخش گياه وجود دارد؟

الف- در نوك ساقه عمدتا" گياهان چوبي                             ب- در با لاي كلاهك عمدتا" گياهان جو بي

ج- در نوك سا قه ونوك ريشه تمام گياهان                          د- در نوك ساقه نزديك به نوك ريشه همه گياها ن

10- مريستم پسين در كدام بخشها ديده مي شود؟

الف- بصورت استوانه اي در ريشه وساقه تمام گيا هان

 ب- بصورت استوانه اي در ريشه وساقه عمدتا"گياهان چوبي چند سله    

ج- در نوك سا قه با لاي كلاهك عمدتا"گيا هان چوبي چند ساله 

د- در نوك ساقه وبا لا ي  كلاهك گياهان چوبي چند ساله

11 - رشد قطري ساقه ها وريشه هاي جواني كه فقط مريستم نخستين دارند چگونه بوجود مي آيد؟

الف- افزايش تعداد سلولها         ب- افزايش طول سلولها          ج- افزايش حجم سلوها               د- تمام موارد

12- سلولهاي جديد حاصل از فعاليت مريتمهاي راسي در ساقها وبرگها به كدام بافتهامتمايز ميشوند؟

الف- بافت نخستین پوستی       ب- افت نخستین زمینه ای       ج- بافت نخستین اوندی               د- تمام موارد

13- كداميك از سلولها تشكيل بخشي از كلاهك ريشه را مي دهند؟

الف- برخي سلولهاي حاصل از مريتسم نزديك به نوك ريشه        ب- برخي سلولهاي حاصل مريتسم نوك ريشه

ج- سلولهاي تمايز يافته از بافت نخستين پوستي                       د- سلولهاي تمايز يافته از بافت نخستين زمينه اي

14- رشد پسين از ويژگيهاي بارز…………است.

الف- گياهان درختچه اي            ب- گياهان چوبي                ج- تك لپه ها             د- تمام گياها ن

15- در كدام بخش از گيا هان علفي ز ير رشد پسين ديده مي شود؟

الف- ساقه لوبيا                       ب- ريشه هويج                   ج- ساقه هويج             د- ريشه جعفري

16- وظيفه ومحل كامبيوم چوب پنبه ساز به ترتيب عبارتند؟

الف- توليد سلولهاي چوب پنبه-درون پوست                          ب- توليد سلولهاي چوب پنبه-ز ير پوست

ج- توليد بافت آوندي-درون پوست                                      د- توليد بافت آوندي-ز ير پوست

17- پوست درخت مجموعا شامل:

الف- چوب پنبه.كامبيوم چوب پنبه ساز                                 ب- كامبيوم چوب پنبه ساز.آبكش پسين

ج- آبكش پسين.چوب پسين                                              د- چوب پنبه.كامبيوم چوبپنبه ساز. آبكش پسين

18- كداميك از بخشهاي زير در زير پوست قرار ميگيرند؟

الف- كامبيوم آوندساز و آبكش پسين                                    ب- چوب پسين وآبكش پسين

ج- آبكش پسين و چوب نخستين                                         د- كامبیوم آوند ساز و چوب پسين

19- كداميك از گياهان زير فاقد لايه چوب پنبه ساز است؟

الف - سرو                          ب- بلوط                              ج- گندم                     د- چنار

20- در كداميك بيشتر نمو پس از بلوغ متوقف ميشود؟

الف- بازدانگان                    ب- جانوران                            ج- گياهان                  د- نهاندانگان

21- كداميك از عناصر بترتيب در ساختار كلروفيل و باز شدن روزنه ها مورد نياز است؟

الف-, N P                 ب-    K , N              ج- P,  K                           دN ,  P -

22- كداميك از هورمونهاي زير از نظر يكي نبودن محل توليد و اثر با بقيه متفاوت است؟

الف- هورمون رشد          ب- اكسين                   ج- ژيبرلين                          د- اتيلن

23- كدام هورمون در چيرگي راسي نقش دارد؟

الف- ژيبرلين                  ب- اتيلن                             ج- اكسين                                 د- آبسيزيك اسيد

24- كداميك از اعمال اكسين نمي باشد؟

الف- بازدارندگي رشد جوانه هاي جانبي                           ب- ريشه دار كردن قلمه ها

ج- امكان طويل شدن سلولها                                        د- تحريك تقسيم سلولي

25- در كنترل سرعت رشد .سنتز پروتئينها و انتقال يونها كدام هورمونها نقش دارند؟

الف- اكسين. اتيلن        ب- اتيلن. اسيدآبسيزيك              ج- آبسيزيك اسيد.ژيبرلين             د- سيتوكينين.ژيبرلين

26- نقش اصلي   ABA كدام است؟

الف- خفتگي دانه و جوانه        ب- سنتز پروتئين               ج- ريزش برگ                          د- پيري

27- ميزان اتبلن در كدام حالت زير كمتر است؟

الف- طي پيري               ب- رسيدگي ميوه                  ج- شرايط هوازي                        د- شرايط غرقابي

28- كدام هورمون تعادل آب را در گياهان تحت تنش خشكي تنظيم ميكند؟

الف- اكسين                   ب- اتيلن                             ج- ژيبرلين                                د- آبسيزيك اسيد

29- تحريك توليد گلهاي نر در گياهاني مانند كدو و خيار توسط كدام هورمون صورت ميگيرد؟

الف- اكسين                   ب- اتيلن                              ج- سيتوكينين                            د- ژيبرلين

30- محل توليد سيتوكينين ها در گياه عبارتنداز:

الف- ساقه ها                  ب- رئوس ريشه                      ج- جوانه هاي انتهايي ساقه            د- ساقه و ريشه

31- براي شادابي شاخه هاي گل و افزايش مدت نگهداري ميوه ها و سبزيجات در انبار كدام هورمون به صورت افشانه استفاده ميشود؟

الف- اكسين                   ب- اتيلن                                ج- ژيبرلين                              د - سيتوكينين

32- در كدام حالت زير ريشه زايي تحريك ميشود؟

الف- نسبت بالاي اكسين به سيتوكينين                             ب- نسبت كم اكسين به سيتوكينين

ج- نسبت بالاي سيتوكينين به اكسين                               د- نسبت كم سيتوكينين به اكسين

33- براي درشت كردن دانه هاي انگور بدون دانه از كدام هورمون ا ستفاده ميشود؟

الف- سيتوكينين               ب- ژيبرلين                             ج- اكسين                              د- آبسيزيك اسيد

34- كدام هورمون به منظور تشكيل ساقه از سلولهاي تمايز نيافته در كشت بافت استفاده ميشود؟

الف- اكسين                    ب- ژيبرلين                           ج- سيتوكينين                            د- اتيلن

35- كدام هورمون نقشي مخالف ژيبرلين ها با جلوگيري از جوانه زني دانه ايفا مي كنند؟

الف- اكسين                    ب- اتيلن                               ج- آبسيزيك اسيد                       د- سيتو كينين

36- ويژگي افزايش تقسيم سلولي مربوط به كداكيك از هورمونها است؟

الف- اتيلن                      ب- اكسين                              ج- ژيبرلين                               د- سيتوكينين

37- آبسيزيك اسيد از نظر تاثير بر سرعت پير شدن برخي اندامهاي گياهي با عمل كدام هورمون متفاوت است؟

الف- سيتوكينين                ب- اكسين                                ج- ژيبرلين                           د- اتيلن

38- جلوگيري از رشد طولي گياهان و تسهيل نمودن برداشت مكانيكي برخي ميوه ها بترتيب توسط كدام هورمونها انجام ميگيرد؟

الف- سيتوكينين.ژيبرلين     ب- اتيلن .اتيلن                ج- اتيلن . ژيبرلين                    د- سيتوكينين . آبسيزيك اسيد

39- كدام هورمون گازي شكل است؟

الف- ژيبرلين                    ب- اكسين                     ج- اتيلن                                د- سيتوكينين

40- در روزهاي گرم و خشك و يا جريان شديد باد ميزان كدام هورمون در گياه افزايش مي يابد؟ (سراسري 80)

الف- آبسيزين                   ب- اكسين                     ج- سيتوكينين                      د- ژيبرلين

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:54  توسط زارع زاده  | 

تست های فصل نهم (تولید مثل در گیاهان) زيست سوم

تست های فصل نهم (تولید مثل در گیاهان)

فصل 9 ( توليد مثل گياهان )

1-سلول هاي كدام، هاپلوئيد است؟ (سراسري 83)

1)تار خزه.                              2)آركگن سرخس.

3)لپه ي گندم.                         4)ريزوم زنبق.

2-كدام سلول براي ژن آنزيم كاتالاز، تنها يك نوع آلل دارد؟ ( با استفاده از سراسري 83)

1)تار خزه.                              2)لپه ي سويا.

3)ريزوئيد سرخس.                  4)اندوخته ي لوبيا.

3-گامتوفيتِ ماده ي كدام، فاقد آركگن است؟ (سراسري 83)

1)خزه.                       2)پنبه.               3)سرو.                          4)سرخس.

4-همتاي آندوسپرمِ كاج، در سرخس كدام است؟ (سراسري 83)

1)پروتال.                   2)هاگينه             3)خورش                       4)اسپوروفيت جوان.

5-گرده افشاني كدام را، حشرات انجام مي دهند؟ (سراسري 82)

1)گل چمن.                 2)گل ستاره.       3)بيد.                            4)بلوط.

 

6-به طور معمول، در دانه ي رسيده ي كدام گياه، تمامي سلول ها، عدد كروموزومي يكسان دارند؟ (سراسري 82)

1)نخود.                     2)ذرت               3)گندم                          4)كاج.

7-در گياه كاج، كدام جزء گامتوفيت ممحسوب مي شود؟ (سراسري 82)

1)تخمك                    2)پولك            ۳)دانه ي بالدار                 4)آركگن.

8-كدام نوع گرده افشاني به طور معمول در يك گل هرمافروديت كه پرچم و مادگي آن با هم در يك زمان مي رسند، انجام مي شودو افراد حاصل به هم و به والد خود شباهت بيشتري دارند؟ (آزاد 83)

1)مستقيم.                  2)به وسيله ي باد 3)مصنوعي         4)به وسيله ي حشرات.

9-در گياهان عالي محصول فعاليت اندام هاي زايا تشكيل كدام گزينه مي باشد؟ (با استفاده از آزاد 83)

1)دانه ي گرده و سپس سلول زايشي.      2)تخمك و سلول زاينده ي تخمك.

3)سلول زاينده ي گرده و دانه گرده.                     4)سلول تخم و سپس دانه.

10-در كدام گياهان دو گامت نر با دو سلول از گامتوفيت ماده تركيب مي شوند؟ به همين دليل به آن لقاح دوتائي گفته مي شود؟ (آزاد 83)

1)نهان زادان آوندي                 2)نهاندانگان.

3)مخروط داران.                      4)خزه گيان.

11-كدام گزينه يك سلول توليد مثلي هاپلوئيد است و گياهي كه از نمو آن حاصل مي شود، چه نام دارد؟ (پزشكي 82)

1)هاگ ـ گامتوفيت                               2)هاگ ـ اسپوروفيت.

3)گامت ـ گامتوفيت.                             4)گامت ـ اسپوروفيت.

12-كدام گزينه برگ هاي تغيير شكل يافته اي هستند كه بخشي از رويان گياه را تشكيل مي دهند و كار آن ها ذخيره يا انتقال مواد غذائي به رويان است؟ (پزشكي 83)

1)لپه ها.                     2)غلاف ها                      3)قلاب ها.         4)پوشش هاي دانه.

13-هاگ كه يك سلول توليد مثلي هاپلوئيد است به كدام طريق حاصل شده و گياهي كه از نمو آن به وجود مي آيد، چه نام دارد؟ (آزاد 82)

1)ميوز ـ گامتوفيت                               2)ميتوز ـ اسپوروفيت.

3)تقسيم دوتائي ـ گامتوفيت.                 4)تقسيم دوتائي ـ اسپوروفيت.

 

14-گامتوفیت ماده در گیاه نهاندانه همان ..... ....است.

4)تخمزا   2  )کیسه رویانی                            1)اسپوروفیت ماده        2)گرده رسیده

15-در تخمک کدامیک بیش از یک گامت ماده بوجود می آید؟

1   )کاج                         2)نخود                        3)گندم                      4)نعناع

16-لقاح در کدام گیاه بوجود آب در محیط وابسته است؟

1)پنبه                      2)سیاه دانه                      3  )بسپایک                    4)سرو

17-کدام بخش خزه تک سلولی است؟

1)آنتریدی       2)آرکگن          3)انتروزوئید                   4)تار

18-در سرخس تعداد کروموزومهای کدامیک با بقیه متفاوت است؟

1   )هاگینه            2)برگ شاخه            3 )پروتال           4)ریزوم

19-از یک سلول مادر هاگ ماده(پارانشیم خورش)چند کیسه رویانی تولید میشود؟

 1)1                   2)2                  3 )4                     4)8

20-منبع تغذیه اسپوروفیت نورسته سرخس کدام است؟

1)آندوسپرم         2)برگ شاخه     3)هاگدان       4)پروتال

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:53  توسط زارع زاده  | 

سوالات تست فصل هشتم زیست شناسی و ازمایشگاه 2

سوالات تست فصل هشتم زیست شناسی و ازمایشگاه 2

 

 

 

 1- در آزمايش هاي مختلف مندل فرزندان حاصل از آميزش والدين :

    1) به يكي از والدين شباهت دارند.    2) 4/1 به يك والد و4/3به والد ديگر شباهت دارند.     

 3) 1/4 به يك والد و2/1 به والد ديگر شباهت دارند. 4) تماماً صفات حدواسط را نشان مي دهند.

 2- اگر فرمول كروموزومي سلول هاي بدن جانداري AaBbCCDD باشد، چند نوع گامت به  وسيله ي اين

جاندار توليد مي شود؟     1) 2                  2) 4                      3) 6             4) 8

  135- فنوتيپ حاصل از آميزش دو خرگوش سياه ناخالص به ترتيب از راست به چپ به چه

 نسبت سياه و به چه نسبت قهوه اي است؟

       1) 3/1 و 3/2                2) 3/2 و 3/1             

   3) 4/1 و 4/2                     4) 4/3 و 4/1  

  3- رابطه ي غالب و مغلوبي در مورد آلل هاي تعيين كننده ي گروه هاي خوني در انسان به  چه نحوي است؟

      1) IA و IB  هر دو نسبت به i غالبند.                                       

       2) IA و IB  هر دو نسبت به i مغلوبند.

      3) IA و i   هر دو نسبت به IB غالبند.                                      

       4) IA وi  هر دو نسبت به IB مغلوبند.

 4- فرد هتروزيگوس به فردي گفته مي شود كه:

      1) الل هاي شبيه داشته باشد.                           2) الل هاي متفاوت داشته باشد.

      3) بعضي ژن هاي او غالب و بعضي مغلوب باشد  4) ژن هاي يكسان داشته باشد.

 5- از خود لقاحي نخود فرنگي دانه صاف ناخالص چه  نسبت هايي به دست مي آيد؟

      1) 100% صاف                                2) 4/1 صاف و 4/3   چروكيده

   3) 2/1 چروكيده و 2/1صاف           4) 4/1 چروكيده و  4/3 صاف

 6- از خودلقاحي گياهي كه در دوصفت هتروزيگوس است و الل ها نسبت به هم رابطه غالب و مغلوبي ندارند

ومستقل از هم منتقل مي شوند، چه نسبتي از فنوتيپ هاي نسل حاصل شبي والدين خواهند شد ه     

           1)8/1                        2) 4/1                       

 3) 8/3                        4) 2/1

 7- اگر الل هاي يك جفت ژن رابطه ي غالب و مغلوبي نداشته باشند ، در افراد نسل دوم كدام

 وضع زير مشاهده خواهد شد؟    

      1) فنوتيپ هتروزيگوس ها از هموزيگوس هاي غالب و نهفته متفاوت خواهد بود.     

      2) نسبت هتروزيگوس ها 3 برابر هموزيگوس ها ي غالب خواهد بود. 

      3) فنوتيپ هموزيگوس هاي غالب و مغلوب شبيه هم خواهد بود.   

       4) فنوتيپ هموزيگوس هاي غالب ، همـوزيگوس هاي مغلوب و هتــروزيگوس ها شبيه به هم خواهد بود.    

 8- اگر ژن A نسبت به a و ژن B نسبت به b  غالب باشد، فنوتيپ كدام ژنوتيپ زير شبيه به هم    خواهد بود؟

AABb , AAbb(2        Aabb , aabb(1

AABB , aaBb(4         AaBb ,AaBB(3

  9- در وراثت دو جفت صفت وقتي غالب و مغلوبي باشد، در 2F به ترتيب از راست   به چپ چند نوع ژنوتيپ

و چند نوع فنوتيپ به دست مي آيد؟  

1) 3 و 1                          2) 4 و 2

   3) 9 و 4                  4) 16  و 9

10- اگر ژنوتيپ والدين AaBb باشد، نسبت افراد هموزيگوس غالب براي هردوصفت در نسل

     اول كدام است؟ 

    1) 16/9               2) 16/3        

    3) 16/2               4)      16/1

11- كدام يك از تعريف هاي زير مفهوم ژن هاي الل را به طور صحيح نشان مي دهد؟

      1) ژن هايي كه اثرشان با هم ظاهر مي شود.                        

      2) ژن هاي  پيوسته روي يك كروموزوم كه اثر مشابه دارند.

      3)     ژن هاي پيوسته در روي يك كروموزوم كه غالب يا مغلوبند.  

      4) ژن هاي هم  رديف كه بر روي دو كروموزوم مشابه واقعند.

 12- تشخيص ژنوتيپ كدام يك به آميزش آزمون نياز دارد؟

      1) گل ميموني قرمز         2) خرگوش سياه         3) اسب سفيد     4) گوساله قرمز روشن

 13- از آميزش aabb × AaBb چه نسبتي از افراد حاصل ژنوتيپ جديدي خواهند داشت؟

      1)2/1                        2) 4/1                             3) 8/3                       4) 16/5

14- مندل در ابتدا نسبت 3 به 1 را در نسل دوم نخودهاي مورد آزمايش چگونه به دست آورد؟

       1) از طريق محاسبات آماري پيچيده       2) از شمارش و جمع بندي اطلاعات به دست آمده

       3) به كمك اصل جور شدن مستقل ژن ها 4) از روي وجود رابطه غالب و مغلوبي در والدين

 15- اگر در جمعيتي با سه گروه خوني متـفاوت ولي با احتـمال يكسان  سه فرد انتخاب كنيم، 

      احتمال اين كه هر سه متفاوت باشند چقدر است؟

      1) 3/2                    2) 9/1                       3) 9/2                           4) 27/1

 16- در سؤال قبلي احتمال يكسان بودن چقدر است؟

      1) 3/2                    2) 9/1                       3) 9/2                  4) 27/1                

 17- اگر هر يك از دو صفت مورد مطالعه داراي چهار سري الل باشند، هنگامي كه هر دو صفت

 را هم زمان مورد مطالعه قرار مي دهيم ، چند نوع ژنوتيپ در هر دو صفت هتروزيگوس خواهيم داشت؟                

  1) 9                   2) 18                     3) 36                 4) 27         

 18- احتمال اين كه از5 فرزند خانواده اي فرزند وسطي دختر و بقيه پسر شود چقدر است؟

       1) 32/1           2) 2/1                        3) 32/10                  4) 5/1       

 19- از آميزش    AaBbccdd × AaBBCcDD     چه نسبت افراد نسل اول داراي ژنوتيپ

      AaBbCcDd مي باشند؟

      1) 8/1                   2) 16/1                      3) 16/3                  4) 8/3            

      153- از آميزش AabbccDd × AABBCcDd چه نسبت افراد نسل اول

 داراي فنوتيــپ ABcd مي باشند؟   

  1) 8/1                   2) 16/1              3) 32/3                 4) 8/3

 20- احتمال آن كه يك مادر سه شكم متوالي فرزند پسر بياورد چقدر است؟

      1) 50%                  2) 25%                    3) 12/5%                   4) 30%     

21- در وراثت دو صفت در صورت نبودن رابطه غالب و مغلوبي بين آن ها تـعداد فنوتيـپ ها

      و ژنوتيپ ها در 2F به ترتيب از راست به چپ كدام است؟          

         1)  6 و 9               2) 9 و9                     3) 8 و 12                  4)   12 و 8

22- چرا صفات وابسته به جنس بيش تر در فرزندان نر ظاهر مي شود؟

      1) الل هاي آن ها روي كروموزوم Y همانندي ندارند.           

       2) الل ها به تساوي روي كروموزوم هاي X و Y توزيع نشده اند.

      3) الل هاي آن ها فقط روي كروموزوم هاي Y اند.                

       4) الل هاي روي كروموزوم Y حالت غالب دارند.

 23- فرزند اول پدر و مادر سالمي مبتلا به فنيل كتونوري است ، احتمال اين كه فرزند دوم آ نها

      دختري مبتلا به اين بيماري باشد چقدر است؟  

  1) 2/1         2) 4/1          3) 8/1        4) 16/1   

  24- دختري سالم و مادرش مبتلا به فاويسم ( صفت وابسته به جنس و مغلوب) است ، اگر اين دختر

      با پسري مبتلا به فاويسم ازدواج كند چه نسبت از فرزندانش دختراني مبتلا به فاويسم خواهند شد؟          

8  /1                   2) 4/1                      

    3) 2/1                      4) 4/3

25- در گنجشك رنگ سياه چشم صفت وابسته به جنس و نسبت به رنگ قهوه اي غالب است. در  آميزش ماده ي

چشم سياه و نر چشم قهوه اي افرا نسل اول چگونه اند؟    

1) تمام نرها چشم سياه                    2) تمام ماده ها چشم

3) نيمي از نرها چشم قهوه  اي       4) نيمي از ماده ها چشم قهوه اي

26- الل هاي 1 ، 2 ، 3 و 4 در رنگ موي خوكچه هندي دخالت دارند. الل 1 بر همه ي الل هاي

      ديگر غالب  است. الل  2 بر الل 3 و  4 غلبه دارد و  الل 3 تـنها بر الل  4 غالب  است  چند  نوع

      . فنوتيپ در چنين جمعيتي قابل پيش بيني است؟

      1) 16                2) 10                 3) 8                  4) 4

27- در كبوتران رنگ بال صفت وابسته به جنس و رنگ خاكستري نسبت به سفيد غالب است .

      از آميزش ماده ي بال خاكستري با نر بال سفيد افراد 1F  چگونه خواهند  شد؟

        1) نيمي از ماده ها سفيد             2) نيمي از نرها سفيد               

       3) تمام ماده ها خاكستري            4) تمام نرها خاكستري

28- خرگوشي با موي سياه و كوتاه با خرگوش ديگر كه موي سفيد و بلند دارد آميزش داده

      مي شود، در نسل اول همه ي خرگوش ها موي سياه و كوتاه دارند در نسل دوم فقط يك

 خرگوش به وجود مي آيد. احتمال اين كه اين خرگوش موي سفيد كوتاه داشته باشد چقدر است؟

     1) 4/1                      2  ) 4/3                        3) 16/1               4) 16/3

29- فنوتيپي كه در افراد هتروزيگوس مي تواند بروز كند كدام است؟

      1) رنگ چشم آبي                     2) آلبي نيسم در زنان           

      3)  بيماري فنيل كتونوري         4) هموفيلي در مردان

30- كوررنگي و هموفيلي بسته به جنس اند. اگر مردي كوررنگ با انعقادخون طبيعي  با زني

هتروزيگوت نسبت به اين دو صفت ازدواج كند، در افراد 1F...........خواهند بود.

 1) پسران همگي كوررنگ و هموفيل                      2) نيمي از فرزندان كوررنگ

 3) نيمي از دختران هموفيل                                  4) همگي فرزندان داراي انعقاد خون طبيع
+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:51  توسط زارع زاده  | 

سوالات تست فصل هفتم زیست شناسی و آزمایشگاه 2

سوالات تست فصل هفتم زیست شناسی و آزمایشگاه 2

سوالات تستی فصل 7 ( ميوز و توليد مثل جنسي )

 

 


1-به طور معمول، در ملخ نر، در هسته ي هر سلول حاصل از ميوزI ، مي تواند مولكول DNA داشته باشد. (سراسري 83)

1) 11             2) 12                 3) 22               4) 23

 

2-كدام گزينه در باره حاصل تقسيم سلول به روش ميوز درست است؟ ( آزاد 76)

1)ايجاد دو سلول ديپلوئيد                                       2)توليد چهار سلول ديپلوئيد

3)توليد دو سلول هاپلوئيد                                   4)ايجاد چهار سلول هاپلوئيد.

 

3-در هنگام تقسيم سلولي به روش ميوز كدام گزينه مشاهده مي شود؟ ( آزاد 76)

1)كروموزوم هاي همتا در مرحله پروفاز I جفت مي شوند.

2)معمولاً سلول هاي ديپلوئيدي تشكيل مي شوند.

3)حاصل تقسيم ايجاد دو سلول است.

4)سلول هاي حاصل كاملاً به هم شبيه اند.

 

4-در تقسيم ميوز، كروموزوم هاي هومولوگ در كدام مرحله تشكيل تتراد مي دهند كه بعد از آن پوسته هسته از بين مي رود؟ (آزاد 78)

1)تلوفاز II         2)تلوفاز I                       3)پروفاز I                      4)آنافاز II 

 

5-در تقسيم سلول به روش ميوز در كدام مرحله رشته هاي كروماتين به شكل كروموزوم در مي آيند و پوسته هسته از بين مي رود؟ ( آزاد 78)

1)آنافاز II          2)پروفاز I                      3)آنافاز I                        4)تلوفاز II 

 

6-از سلولي كه داراي 8 كروموزوم مي باشد، هنگام تقسيم ميوز، در مرحله پروفازI ، چند تتراد تشكيل مي شود؟ (آزاد 79)

1) 3                 2) 8                             3) 4                             4) 16

 

7-كدام ويژگي خاص تقسيم ميوز است؟ (سراسري 76)

1)دو مرتبه همانند سازي.

2)جدائي كروموزوم هاي هومولوگ.

3)دو مرتبه تقسيم سانترومر.

4)جدائي كروماتيدهاي خواهري.

 

8-در مورد تتراد كروموزومي، كدام جمله صحيح است؟ ( سراسري 78)

1)يك كروموزوم كه چهار سانترومر دارد.

2)چهار كروموزوم هومولوگ كه مجاور هم قرار دارند.

3)دو جفت كروموزوم همتا و دو كروماتيدي كه از طول مجاور و متصل هستند.

4)يك جفت كروموزوم همتا و مضاعف كه از طول مجاور و متصل هستند.

 

9- سلولي كه داراي     24= n2  است . هنگام ميوز چند تتراد تشكيل مي دهد؟

ا) 4                    2) 6                  3) 12                 4) 24

 

10- در سلولي با 4= n2 در مرحله متافاز چند نوار پلي نوكلئوتيدي وجود دارد؟

1)4                    2) 8                   3)16                 4)24

 

11- در آخر آنافاز ميوز II هر يك كروموزوم بترتيب داراي چند كروماتيد و چند سانترومر است؟

1) 1و1              2) 2 و1             3) 1و2                  4) 2 و 2

 

12- در ميوز تقسيم سانترومرها و تقسيم سيتوپلاسم براي تشكيل هسته nكروموزومي مضاعف مربوط به كدام است؟

1) آنافاز II تلوفاز II                 2) آنافاز II – تلوفاز I        

3) آنافاز I  - تلوفاز II                  4) آنافاز I تلوفاز I

 

13- سلول فرضي با 4 = n2 در پايان مرحله اول ميوز هر سلول داراي …………… است.

1) دو كروموزوم غير مشابه           2) چهار كروموزوم غير مشابه  

 3) دو كروموزوم مشابه               4) چهار كروموزوم مشابه

 

14- سلول فرضي داراي 8= n2 در متافاز ميوز I داراي ………

1) چهار كروموزوم جهار كروماتيدي است .      

2) داراي 16 سانترومر است.                                                             

3) يك صفحه كروموزومي است .                                         

4) داراي چهار سانترومر است.

 

15- اگر تعداد سانترومرهاي تترادي پروفاز ميوز اول 28 عدد باشند.سلول اوليه داراي چند كروموزوم است؟

1) 56                  2) 28                          3) 14                          4) 7

 

16- اولين متافاز ميوز و ميتوز را از روي كدام نشانه راحت تر تشخيص مي دهند؟

1) محل استقراركروموزوم ها                                                

2) طرز اتصال كروماتيدها به سانترومر                                                                  

   3) تعداد كروموزومهاي دو كروماتيدي                                   

4) طرز استقرار كروموزوم ها در روي دوك

 

17- اگر تعداد نوكئوتيدهاي ژن ها را ثابت فرض بگيريم , در كروموزوم شماره 17 و 12 انسان بترتيب :

1) ژن كمتر – نوكلئوتيد بيشتر                                               

 2) نوكلئوتيد كمتر ژن كمتر

3) نوكلئوتيد بيشتر ژن بيشتر                                             

 4) نمي توان مشخص كرد.

 

 

18- كداميك از سلولهاي زير داراي DNA بيشتري است؟

1) اسپرم تمايز نيافته                        2) اسپرم نابالغ                        

3) سلول زاينده اسپرم                        4) دومين گويچه قطبي

 

19- همگي مربوط به توليد مثل غير جنسي است به جز:

1) فقط يك والد شركت دارد.                                   

2) فردي كه بوجود مي آيد يك كلون است.

3)فرزند دقيقا مشابه يكي از دو والد نيست.                  

4) دوتايي نوعي توليد مثل غير جنسي است.

 

20- در كدام موجود سلول هاي هاپلوئيد قسمت بيشتر چرخه زندگي را در بر مي گيرد؟

1) كلاميدوموناس                                       2) كاج                 

   3) انسان                                            4 ) موش

 

21-كدام يك به طريق ميتوز گامت مي سازد؟

1) جلبك ها         2) انسان         3) ماهي             4) باكتري

 

22- در كداميك زيگوت تقسيم ميتوز انجام مي دهد؟

1) چرخه زندگي ديپلوئيدي    2) چرخه زندگي هاپلوئيدي  

3) كلاميدوموناس             4) قارچها

 

23- در گياهان كداميك مستقيما گامتوفيت توليد مي كند؟

1) هاگ              2) زيگوت                 3) گامت               4) اسپوروفيت

 

24- تفاوت چرخه هاپلوئيد ديپلوئيد و تناوب نسل در كدام است؟

1) كدام مرحله به جانور پر سلولي تبديل مي شود.                                        

 2) تقسيم ميتوز انجام مي دهد.

3) تقسيم ميوز انجام مي دهد.                                                               

4) زيگوت تشكيل مي شود.

 

25- ساده ترين نوع چرخه زندگي در موجوداتي كه توليد مثل جنسي دارند كدام است؟

1) تقسيم دو تايي      2) هاپلوئيدي         3) ديپلوئيدي       4) تناوب نسل

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:50  توسط زارع زاده  | 

سوالات تست فصل ششم زيست سوم

سوالات تست فصل ششم زيست سوم

 

1-در كدام مراحل چرخه ي سلولي، هر كروموزوم، دو كروماتيد و يك سانترومر دارد؟ (سراسري 83)

1) G1 و G2

2) G2 و پروفاز ميوز II

3)متافاز و تلوفاز ميتوز.

4) S و تلوفاز ميوز II

 

2-تيغه ي مياني سلول هاي گياهي را كدام مي سازد؟ (سراسري 82)

1)غشاء.

2)ديواره ي ثانويه.

3)دستگاه گلژي.

4)ديواره ي نخستين.

 

3-در كدام مرحله از مراحل ميتوز كروموزوم ها به وسط سلول حركت و در سطح استوائي سلول رديف مي شوند و دو كروماتيد هر كروموزوم حداكثر فشردگي را پيدا مي كنند؟ (پزشكي 82)

1)تلوفاز.

2)پروفاز.

3)متافاز.

4)آنافاز.

 

4-در مرحله آنافاز تقسيم ميتوز كدام تغييرات در سلول قابل مشاهده است؟ (آزاد 77 )

1)فعاليت هاي ماده سازي و مواد لازم براي بزرگ شدن سلول تهيه مي شود.

2)ملكول DNA سنتز و مضاعف مي گردد.

3)كروماتيدها از هم جدا مي شوند و كروموزومها به دو طرف سلول مي روند.

4)پوسته هسته از ميان مي رود و دوك پديد مي آيد.

 

5-هر كروموزوم از دو نيمه تشكيل شده، نام هر يك چيست؟ (آزاد 78)

1)كروماتين.

2)نوكلئوزوم.

3)سانتروزوم.

4)كروماتيد.

 

6-اعضاي يك جفت كروموزوم هم شكل و همانند را نسبت به يكديگر چه مي نامند؟ (آزاد 79)

1)هاپلوئيد.

2)ديپلوئيد.

3)هيبريد.

4)هومولوگ.

 

7-كدام يك مفهوم نوكلئوزوم است؟ ( س 75)

1)واحدهاي هيستوني و قسمتي از مولكول DNA .

2)واحدهاي هيستوني و يك مولكول DNA .

3)يك مولكول هيستون و قسمتي از مولكول DNA .

4)يك مولكول هيستون و يك مولكول DNA .

 

8-جنسيت ملخ XO مانند كدام است؟ (س 75)

1)انسان XO .

2)پروانه XY .

3)گنجشك XX .

4)مگس سركه XXY .

 

9-تشکیل دوک و غشای هسته بترتیب در کدام مراحل از تقسیم میتوز صورت می گیرد؟

1- پروفاز – پروفاز                 

2- پروفاز – تلوفاز   

3- تلوفاز – پروفاز    

 4- تلوفاز - تلوفاز

10- در کدام یک از سلولهای زیر تقسیم سیتوپلاسم با پیوند خوردن وزیکولهایی در میان سلول صورت می گیرد؟

1- کبد                       2- ماهیچه         

3- لوزالمعده   4- نخود

 

11- انجام میتوز بدون سیتوکینز در سلول سوماتیک منجر به :

1- تولید سلول تمایز یافته و طبیعی میشود.

2- مرگ سلول میشود.

3- توقف چرخه سلول میشود.                        

4- تولید سلولهای چند هسته ای میشود.

12- واحدهای هیستونی موجود در کروموزوم در مرحله متافاز توسط چند رشته پلی نوکلئوتیدی احاطه میشود؟

2- 1             2- 2                 3- 4                 4- 8

 

13- در کدام مرحله از چرخه سلولی پیوند  DNAبا هیستون اطراف آن در سراسر رشته DNA گسسته می شود؟

1- G1                      2- S                 3- G2              4- میتوز 

                                                                                                          

14- در انتهای مرحله S چرخه سلولی در سلولی با  2n=8 حداکثر چند الل از یک ژن وجود دارد؟

1- 4             2- 8                 3- 12               4- 16

15- در سلول بدنی در انتهای پروفازمیتوزچند میکروتوبول در سانتریولها وجود دارد؟

1- 27                       2- 54               3- 108             4- 216

 

16- در پروفاز میتوز سلولی با 2n=6 چند مولکول DNA وجود دارد؟

1- 3             2- 6                 3- 12               4- 24

 

17- در سلولی با 2n=6 در مرحله متافاز دارای چند نوار پلی نوکلئوتیدی می باشد؟

1- 24                       2- 16               3- 8                 4- 4

 

18- سول تریپلوئیدی که 12 کروموزوم دارد، دارای ....دسته کروموزوم میباشد که کروموزومهای هر دسته ...... می باشد    ( سراسری 74)

1- سه – همولوگ                      

2- سه – غیرهمولوگ  

3- چهار- غیرهمولوگ      

4- چهار- همولوگ

 

19-کدام یک از رویدادهای زیر در میتوز صورت نمی گیرد؟

1- تغییر در ساختمان کروماتین              

2- نمایان شدن مجدد هستکها

3- همانندسازی DNA             

4- حرکت سانتریولها به قطبین سلولی

20- در سلول بدون سانتریول کدام عمل هنگام تقسیم سلول رخ نمی دهد؟

1- تشکیل دوک                                   

2- جداشدن کروماتیدهای خواهری

3- ایجاد فرورفتگی در سیتوپلاسم                       

4- متراکم شدن رشته های کروماتین

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:49  توسط زارع زاده  | 

سوالات تست فصل پنجم زیست شناسی و ازمایشگاه 2

سوالات تست فصل پنجم زیست شناسی و ازمایشگاه 2

 

1-در چرخه ي زندگي يك سلول يوكاريوتي، وقتي مرحله ي ميتوز به پايان مي رسد، معمولاً كدام مرحله آغاز مي شود؟ (آزاد83)

1-  سنتز

2- نخستين مرحله ي رشد

3- سيتوكينز

4- دومين مرحله ي رشد

 

2-كدام ماده اجزائي دارد كه، باعث ساخته شدن كپسول در باكتري هاي بدون كپسول استرپتوكوكوس نومونيا مي شود؟ (پزشكي 82)

1- ريبونوكلئيك اسيد

2- اينترفرون

3- دئوكسي ريبونوكلئيك اسيد

4- اپي نفرين

 

3-باز مكمل آدنين، در مولكول DNA و در مولكول RNA به ترتيب كدام دو باز هستند؟ (آزاد82)

1- گوانين و تيمين

2- تيمين و اوراسيل

3- اوراسيل و سيتوزين

4- سيتوزين و گوانين

 

4-شكل زير كه مرحله سيتوكينز چرخه ي سلولي را نشان مي دهد، در ارتباط با كدام گزينه است؟ (آزاد 82)

1- سلول جانوري

2- استرپتوكوكوس نومونيا

3- اريتروسيت

4- سلول گياهي

 

5- در كداميك از سلولهاي زير  دو راهي همانند سازي در يك نقطه ي خاص بوجود مي آيد ؟

1- استرپتوكوكوس          

2- سلول موش                   

3- سلول نخود فرنگي        

 4- سلول انسان     

 

6- گزينه صحيح را انتخاب كنيد .

1- DNA پليمراز فقط خاصيت پليمرازي دارد .      

 2- باكتريها فقط يك دوراهي همانند سازي ايجاد مي كنند .

3- خاصيت ويرايش DNA پليمراز از بروز اشتباهات بيشتر در همانند سازي جلو گيري مي كند .

4-          كروموزوم هاي انسان هنگام همانند سازي معمولا دو دوراهي همانند سازي ايجاد مي كنند .

 

7- ضمن ترانسفورماسيون در ديپلوكوكوس كدام پديده اتفاق مي افتد ؟ 

1- انتقال كپسول به باكتري بي كپسول            

 2- انتقال ماده ژنتيكي از باكتري كپسول دار به بي كپسول

3- جهش در عدهاي از ژنهاي مسئول تشكيل كپسول 

 4- كراسينگ اور بين باكتري هاي كپسول دار و بي كپسول

 

8- اگر تعداد نوكلئوتيدهاي آدنين دار در يك نوع DNA که دارای 120 نوکلئوتید

است30 نوکلئوتید  باشد  تعداد پیوندهای هیدروژنی  در این مولکول کدام است؟

1- 60                         

 2 – 120                       

 3 - 150                       

 4- 240

 

9- هنگام همانندسازی کدام پیوندها شکسته و کدام پیوندها تشکیل می شوند؟

1- هیدروژنی – هیدروژنی            

2- هیدروژنی – هیدروژنی و فسفودی استری

3- فسفو دی استری- هیدروزنی و فسفو دی استری     

4- فسفوداستری- هیدروژنی

 

10- چنانچه در بخشی از DNA فرضي 20% نوكلئوتیدها سیتوزین دار باشد. نسبت نوکلئوتیدهای پورین کدام است؟

1- 25%                             2- 30%                               3- 50%                                    4-60%

 

11- هنگام همانند سازی قسمتی از DNAفرضی با توالی ACGTTC چند پیوند فسفات پر انرژی در نوکلئوتیدهای جدید شکسته خواهد شد؟

1- 6                             2- 12                         3- 13                          4- 24

 

12- اختلاف ATP با نوکلئوتید آدنین دار اسیدهای نوکلئیک در این است که اولی ..............

1-  باز آلی بیشتر از دومی دارد.                 

2- فسفات کمتر از دومی دارد.

3- دوفسفات بیشتر از دومی دارد.               

4- قند ریبوزدارد.

 

13- گسستگی کدام نوع از پیوندها سبب گسستگی در هر زنجیره مولکول DNA میشود؟

1- بازآلی - فسفات           

2- فسفات – قند              

3- قند – باز آلی

4- هیدروژنی

 

14- اگر مولکول DNAدارای 300 جفت باز باشدچند گروه فسفات در مولکول DNA مشاهده می شود؟

1- 150                         2- 300             3- 450             4- 600

 

15- فراوانی A در یک رشته DNA 20% و در رشته دیگر 26% است. فراوانی C در مولکول DNA چقدر خواهد بود؟

1- 4%                          2- 14%                        3- 23%                        4- 27%

 

 

16- كدام رابطه زير در مقايسه DNA جانداران مختلف صحيح است؟

1-  A/Gدر تمام DNA ها يكسان است .                  

2- A+C/G+T در تمام DNA  ها يكسان است .

3- A+T/G+C در تمام DNA ها يكسان است.          

4- G/T در تمام DNA  ها يكسان است.

17- در يك مولكول DNA نوكلئوتيد آدنين دار 15% است تعداد نوكلئوتيد هاي گوانین دار آن چند درصد است؟

1- 15%                      2- 30%                        3- 35%                            4- 85%

18- در يك زنجيره DNA اتصال نوكلئوتيد ها با يكديگر چگونه صورت مي گيرد؟

1- باز- باز                                        2- قند – باز                   

  3- فسفات – قند                                           4- باز – فسفات 

19-اگر در قسمتي از DNA  32 نوكلئوتيد باشد و تعداد نوكلئوتيد هاي

 AوC  برابر باشد هنگام همانند سازي اين بخش  نياز  به چند مولكول

 نوكلئوتيد G  است؟

1- 4                          2- 8                 3-12                4- 16

20- ژنوم باكتريها بصورت ......................... است .

1- تك رشته و خطي       2- تك رشته و حلقوي  

 3- دو رشته اي و حلقوي       4- دو رشته و خطي

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:47  توسط زارع زاده  | 

سوالات تست فصل چهارم زیست شناسی و آزمایشگاه 2

1-شكل زير در ارتباط با ساختار كدام غده مي باشد؟ (آزاد 83)

1)زيرزباني                    2)فوق كليوي       3)پانكراس                       4)پاراتيروئيد

 

2-كدام، از ترشحات غده ي برون ريز محسوب مي شود؟ (سراسري 83)

1)ليزوزيم                      2)سكرتين                        3)كورتيزول                     4)اكسي توسين

 

3-به طور معمول، در بدن انسان، در مواجهه با فشارهاي روحي طولاني مدت، كدام روي نمي دهد؟ (سراسري 83)

1)كاهش پروتئين ها                      2)افزايش پتاسيم خون        

           ۳)كاهش سديم ادرار                       4)افزايش گلوكز خون

 

4-كدام در مورد انسان، صحيح است؟ (سراسري 83)

1)آلدوسترون، با بازجذب سديم، فشار خون را افزايش مي دهد.

2)گلوكاگون، باعث تبديل گلوكز به گليكوژن ذخيره اي مي شود.

3)ملاتونين، معمولاً در پاسخ به روشنائي تررشح مي شود.

4)ديابت نوع دوم، معمولاً در سنين كودكي عارض مي شود.

5-با افزايش فعاليت غدد پاراتيروئيد،‌كلسيم (سراسري 82)

1)در خون افزايش مي يابد.             2)در استخوان افزايش مي يابد.

3)از روده كمتر جذب مي شود.         4)در كليه كمتر بازجذب مي شود.

 

6-افزايش ترشح كدام هورمون، بر قند خون اثر افزاينده ندارد؟ (سراسري 82)

1)آدرنالين                     ۲)کورتيزول                     3)گلوكاگون                      4)انسولين

 

7-كدام دو غده ي درون ريز بدن ترشح اوليه بسياري از هورمون ها را كنترل مي كنند و به عنوان مركز اصلي تنظيم كننده عمل مي نمايد؟ (پزشكي 82)

1)هيپوتالاموس و هيپوفيز  2)هيپوفيز و پانكراس                    

           3)پينه آل و هيپوفيز                       4)پانكراس و پينه آل

 

8-كدام دو هورمون استروئيدي بوده و به علت حل شدن در چربي غشاي سلول ميتواند از آن بگذرد؟ (آزاد 82)

1)انسولين                                  2)تيروتروپ                                3)سوماتوتروپ                 4)آلدوسترون

 

9-كدام دو غده، مواد خاصي به درون ساختار هاي لوله مانند خود كه مجرا ناميده مي شوند، ترشح مي كنند و به نام غده هاي برون ريز ناميده مي شوند؟ (آزاد 82)

1)پينه آل و پاراتيروئيد                 

                       2)وزيكول سمينال و پروستات          

           3)پاراتيروئيد و وزيكول سمينال        

4)پانكراس و پينه آل

 

10- مهم ترين هورمون تنظيم كننده ي قند خون كدام است؟  

1) آدرنالين                       2) كورتيزول                    3) انسولين                         4) گلوكاگون

 

11- منبع ترشح ، ساختمان شيميايي و عمل آلدوسترون به ترتيب عبارتست از:

1) بخش قشري غده فوق كليه ، استروئيد ، بازجذب سديم در كليه     

  2) بخش مركزي غده فوق كليه ، استروئيد ، بازجذب قند در كليه

3) بخش قشري غده فوق كليه ، پلي پپتيد ، باز جذب سديم در كليه    

 4) بخش مركزي غده فوق كليه ، پلي پپتيد ، بازجذب قند در كليه

 

12- كدام هورمون از اتلاف سديم جلوگيري مي كند؟

1) آدرنالين        2) آلدوسترون          3) كورتيزول                4) گلوكاگون

 

13- نتيجه ي عمل هورمون كورتيزول بر مقدار گلوكز خون بر خلاف عمل كدام هورمون است؟

1) انسولين        2) آدرنالين                                    3) تيروكسين        4) گلوكاگون

 

14- كمبود انسولين موجب كدام دو مورد مي شود؟

1) افزايش قند ادرار – كاهش حجم ادرار                                  2) كاهش قند ادرار – افزايش حجم ادرار

3) افزايش قند ادرار – افزايش حجم ادرار                                 4) كاهش قند ادرار – كاهش حجم ادرار

 

15- كدام هورمون به پيك ثانوي نياز دارد؟

1) گلوكاگون                                 2) كورتيزول                      3) آلدوسترون                4) استروژن

 

16- در انسان از دوره ي كودكي تا بلوغ وزن كدام غده به تدريج كم مي شود؟

1) هيپوفيز                 2) فوق كليه            3) تيموس                 4) پاراتيروئيد

 

17- در مقايسه ي عمل غده هاي داخلي و دستگاه عصبي به ترتيب از نظر سرعت عمل و دوام اثر چگونه اند؟

1) هر دو سريع و كم دوام                                          2) عصبي كند و كم دوام ، غده هاي داخلي سريع و بادوام

3) هر دو كند و با دوام                                                         4) عصبي سريع و كم دوام ، غده هاي داخلي كند و با دوام

 

18- ساختار بخش هاي پيشين، مياني و پسين هيپوفيز به ترتيب چگونه است؟

1) غده اي – غده اي – عصبي                                              2) عصبي – غده اي – غده اي

3) غده اي – عصبي – غده اي                                               4) غده اي – عصبي – عصبي

 

19- هورمون كدام غده موجب تقويت و تشديد آثار اعصاب سمپاتيك مي شود؟

1) تيروئيد              2) پاراتيروئيد              3) مركز فوق كليه                 4) قشر فوق كليه

 

20- كدام يك از هورمون هاي زير در هيپوتالاموس ساخته شده ودر كجا ذخيره مي شوند؟

1)ADH و كلسي تونين – در پاراتيروئيد                                

2) ضد ادراري و اكسي توسين – در هيپوفيز پيشين

3)ADH و اكسي توسين – در هيپوفيز پسين                            

                        4) گلوكاگون و انسولين – در لوزالمعده

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:43  توسط زارع زاده  | 

سوالات تست فصل سوم زیست شناسی و آزمایشگاه 2

سوالات تست فصل سوم زیست شناسی و آزمایشگاه 2

۱-كدام عبارت در مورد «دور بيني» صحيح است؟ (سراسري 82)

1)تحدب عدسي زياد مي شود.                      2)با عدسي مقعر تصحيح مي شود.

3)قطر كره ي چشم زياد مي شود.                 4)تصوير اشياي نزديك در پشت شبكيه تشكيل مي شود.

 

2-فرد مبتلا به آستيگماتيسم، با كدام اختلال مواجه است؟ (سراسري 82)

1)كدر شدن عدسي.           2)عدم يكنواختي انحناي قرنيه.          

           3)كاهش قدرت تطابق                     4)تغيير اندازه ي كره ي چشم.

 

3-در كدام جانور، تحريك هر نقطه ي بدن، پاسخ عمومي بدن را در پي دارد؟ (سراسري 82)

1)سنجاقك                      2)شقايق دريائي                3)پلاناريا                                    4)كرم خاكي.

 

4-كدام گزينه مواد غذائي و اكسيژن را براي عدسي و قرنيه چشم فراهم مي كند، و مواد دفعي را نيز جمع آوري نموده تا از طريق خون دفع شوند؟ (پزشكي 82)

1)زجاجيه                      2)زلاليه                          3)شبكيه                          4)صلبيه

 

5-در مغز انسان، پردازش اطلاعات شنوائي در كدام لوب انجام مي شود؟ (پزشكي 82)

1)پس سري       2)پيشاني                                    3)آهيانه                          4)گيجگاهي

 

6-حشرات كه به بسياري از محرك ها پاسخ مي دهند، نسبت به كدام يك از محرك ها بسيار حساس هستند؟ (پزشكي 82)

1)نوري                        2)صوتي                         3)لمسي                          4)شيميائي

 

7-ساده ترين گيرنده ي نوري در كدام جانور وجود دارد و به كدام نام موسوم است؟ (آزاد 82)

1)زنبور عسل ـ چشم مركب 2)پلاناريا ـ چشم مركب                   

           3)پلاناريا ـ چشم جامي شكل  4)خرچنگ ـ اندام جامي شكل

 

8 - انتهاي هر يك از گيرنده ها شامل :                               

1) دندريت يك نورون است .                     2) اكسون يك نورون است .                                                 

3) دندريت يك يا چند نورون است .              4) اكسون يك يا چند نورون است .

 

9- گيرنده درد چه هنگام تحريك مي شود ؟

1) سرماي شديد                                  2) گرماي شديد     

3) فشار شديد                                     4) تحريكات شديد كه احتمال اسيب به بافت را ايجاد كند .

 

10 - محل گيرنده هاي مكانيكي حساس به فشار خون كدام بخش است ؟

1) ديواره برخي از رگهاي خوني   2)هيپو تالاموس                3) تالاموس         4) ديواره تمام رگهاي خوني

 

11- خارجي ترين لايه كره چشم چه نام دارد و مشخصات آن كدام است ؟

1) صلبيه - نازك و رنگدانه دار                    2) مشيميه - نازك و رنگدانه دار

3) صلبيه - محكم و سفيد رنگ                    4)مشيميه - محكم و سفيد رنگ

 

12- بخش رنگين چشم در جلو ................. است كه از لايه ...................... تشكيل مي شود .

1) قرينه - صلبيه        2) عنبيه - صلبيه           3) عنبيه - مشميه            4 ) قرينه – مشميه

 

13- گيرنده هاي نوري چشم در كدام لايه قرار دارند ؟

1) شبكيه                  2)مشيميه                      3) صلبيه                       4)عنبيه

14- زلاليه ..................... است كه در .......................... نقش دارد .

1) ماده ژله اي شفاف- حفظ كرويت چشم                       2) مايع شفاف - حفظ كرويت چشم .

3) مايع شفاف - تغذيه .                                             4) ماده ژله اي و شفاف- تغذيه .

15- در احساس تعادل كدام گيرنده نقش دارد ؟

1) سلول هاي تاژك دار موجود در حلزون گوش                

  2) سلول هاي تاژك دار موجود در مجاري نيم دايره

3) سلولهاي مژك دار موجود در حلزون گوش                 

 4)سلولهاي مژك دار موجود در مجاري نيم دايره

 

 16- بترتيب بيماري هاي"كدر شدن عدسي ،كوچك بودن كره ي چشم و عدم انعطاف عدسي" چه ناميده مي شوند ؟

1) دوربيني،آستيگماتيسم،پيرچشمي                                 2) پيرچشمي،آستيگماتيسم،كوررنگي

   3) آب مرواريد،دوربيني،پيرچشمي                               4) آستيگماتيسم،دوربيني،نزديك بيني

 

17-عصب كدام اندام حسي از دو جزء تشكيل شده است ؟

1 ) چشم                            2) گوش              3) زبان                           4)  بيني

 

18-در كدام گزينه لايه هاي چشم از داخل به خارج بيان شده است ؟

1) شبكيه،عنبيه،صلبيه                       2)صلبيه،مشيميه،شبكيه 

  3) شبكيه،مشيميه،صلبيه         4) عنبيه،مشيميه،قرنيه

 

19- كدام گزينه ترتيب نور در چشم انسان را بدرستي نشان ميدهد ؟

1) قرنيه ،زجاجیه ، مشيميه ، زجاجيه ، عدسي ، شبكيه        

  2 ) قرنيه ، زلاليه ، مردمك ، عدسي ، زجاجيه ، شبكيه                                                      

  3 ) قرنيه ، زلاليه ، عدسي ، مشيميه ، زجاجيه ، شبكيه           

  4) قرنيه ، زجاجیه ، عدسي ، مردمك ، شبكيه ، زلاليه 

 

20- پردازش اطلاعات چشايي و شنوايي بترتيب در كدام لوب هاي مغز انجام ميشود ؟

1) آهيانه – پيشاني               2) آهيانه – گيجگاهي        

     3) گيجگاهي ­– پس سري         4) پس سري – پيشاني  

 

21- ماهيچه هاي مژكي به ------ متصلند .

1) صلبيه                  2) قرنيه                          3) شبكيه                              4) مشيميه

 

22- كدام يك از گيرنده هاي پوست داراي بن مايسنر هستند ؟

1) گيرنده لمس               2) گيرنده گرما           3)  گيرنده سرما                       4) گيرنده درد

 

23- كدام گيرنده حسي پوست محرٌُك خاصي ندارد ؟

1) گيرنده لمس          2)  گيرنده درد                             3) گيرنده فشار                        4)  گيرنده سرما

 

24- گيرنده هاي فشار خون در ----- وجود دارد و اطلاعات را به ----- منتقل ميكند .

1) ديواره رگها – بصل النخاع                                          2) زير سطح پوست – مغز

3) ديواره رگها – نخاع                                                  4) زير سطح پوست –  ساقه مغز   

 

25- در ميان سلولهاي گيرنده نور بترتيب كدام يك بيشتر در شب تحريك ميشوند و تعداد كدام يك در بدن بيشتر است ؟

1) استوانه اي - مخروطي                                              2)  مخروطي - مخروطي                                           

  3) مخروطي -  استوانه اي                                            4)  استوانه اي - استوانه اي ­­

 

 

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:22  توسط زارع زاده  | 

سوالات تست فصل دوم زیست شناسی و ازمایشگاه 2

سوالات تست فصل دوم زیست شناسی و ازمایشگاه 2

 

1-در يك سلول عصبي، در حال استراحت، …… (سراسري 83)

1)سديم به درون وارد نمي شود.                               2)پمپ سديم ـ پتاسيم فعال نيست.

3)كانال هاي دريچه دار سديم، بسته است.                    4)كانال هاي دريچه دار پتاسيم، باز است.

 

2-كدام، فاقد گره ي عصبي است؟ (سراسري 83)

1)زنبور.                       2)پلاناريا.                       3)ملخ                 4)هيدر.

 

3-در منحني مقابل، مرحله اي كه با علامت سؤال مشخص شده است، نشان دهنده ي كدام است؟ (سراسري 82)

1)خروج ناگهاني يون هاي پتاسيم                              2)ورود ناگهاني يون هاي سديم.

3)فعاليت زياد پمپ سديم ـ پتاسيم بعد از پتانسيل عمل.   4)برگشت غلظت يون ها در دو سوي غشاي سلول به حالت اوليه.

 

4-هدايت پيام عصبي در رشته هاي داراي ميلين و رشته هاي دارنده ي قطر زيادتر به ترتيب چگونه است؟ (آزاد 82)

1)تندتر ـ آهسته تر                        2)آهسته تر ـ كندتر             3)سريع تر ـ تندتر              4)كندتر ـ سريع تر

 

5-ماده ي خاكستري دستگاه عصبي مركزي از كدام گزينه تشكيل شده است؟ (آزاد 82)

1)اجتماع دندريت ها                      2)جسم سلولي نورون ها      3)غلاف ميلين                  4)اجتماع آكسون ها

 

6- بازاي مصرف ملكول یکATP   توسط پمپ سديم . پتاسيم چند يون پتاسيم و در چه جهتي جابجا مي شود ؟  

1) 3- داخل سلول           2)2 - خارج سلول             3) 2 - خارج غشاء                            4) 3 - داخل غشاء

 

7- علت بالا رفتن و پايين رفتن اختلاف  پتانسيل عمل به ترتيب مربوط به كدام است ؟

1) ورود سديم به داخل : خروج سديم از سلول                                    2) ورود پتاسيم به سلول :خروج پتاسيم از سلول .

3) ورود ناگهاني سديم به داخل سلول : خروج ناگهاني پتاسيم از سلول           4) ورود ناگهاني پتاسيم به سلول : خروج ناگهاني سديم از سلول

 

8- با پايان يافتن پتانسيل عمل ، فعاليت پمپ سديم . پتاسيم و ميزان سديم داخل سلول به ترتيب چه تغييري مي يابند ؟

1) كمتر : كمتر              2) بيشتر : كمتر                               3) كمتر : بيشتر                  4)بيشتر : بيشتر

 

9- كدام يك ماده روان گردان محسوب نمي شود ؟

1) الكل                         2)نيكوتين                                      3) گلوتامات                      4) كافئين

 

10- جسم پينه اي چيست و جنس ان كدام است ؟

1) رابط 2 نيمكره مخچه : دندريت ها                                        2) رابط 2 نيمكره مخچه : اكسون ها

3) رابط 2 نيمكره مخ : دندريت ها                                            4) رابط 2 نيمكره مخ : اكسون ها

 

11- بيش ترين پردازش اطلاعات حسي و حركتي در ................ مخ انجام مي شود .

1) قشر خاكستري          2)قشر سفيد                                   3) مركز خاكستري            4) مركز سفيد 

               

12- محل تقويت پيام هاي حسي و سپس ارسال به قشر مخ وظيفه كدام بخش است ؟

1)مغز مياني                     2)بصل النخاع               3)هيپوتالاموس                             4)تالاموس 

                                                                     

  13-  تنظيم بسيار از اعمال غده هاي ترشح كننده ي هورمون ها بعهده كدام قسمت است ؟

1) تالاموس                      2)هيپوفيز                                3) هيپوتالاموس                 4) بصل النخاع

14- هيپوتالاموس به همراه كدام قسمت در تنظيم فعاليت هاي تنفس و جريان قلب شركت مي كند ؟   

1) تالاموس                      2) هيپوفيز                                3) بصل النخاع                4) ليمبيك

15- هر عصب نخاعي شامل :

1) يك ريشه پشتي            2) يك ريشه شكمي             3) يك ريشه پشتي يا شكمي     4)يك ريشه پشتي و يك ريشه شكمي

 

16- ريشه هاي شكمي عصب نخاعي محتوي :

1) نورون هاي حركتي اند                                                                                      2) نورون هاي جسمي اند  

  3) اطلاعات حسي را از گيرنده حسي به دستگاه عصبي مركزي مي برد                                          4) نورون حسي و حركتي اند

 

17 -اولين عامل حفاظت دستگاه عصبي مركزي پستانداران عبارتست از :

1) مايع مغزي ـ نخاعي            2) سد خوني ـ مغزي                  3) پرده مننژ                               4) استخوانهاي جمجمه وستون مهره ها

18- داخلي ترين لايه پرده مننژ كدام و چه نقشي دارد ؟

1)سخت شامه : ضربه گير                                                    2) نرم شامه : تغذيه بافت عصبي

3)سخت شامه : تغذيه بافت عصبي                                          4)نرم شامه : ضربه گير

19- تعداد نورون هاي مورد استفاده در انعكاس زردپي زير زانو كدام است ؟

1) يك حسي و يك حركتي                                                  2) يك حسي و 2 حركتي    

3) يك حسي و يك رابط و 2 حركتي                                                  4) 2 حسي و يك رابط و يك حركتي

 

20- دستگا ه عصبي در پلاناريا شامل :

1) مغز و 2 طناب عصبي موازي است                                  2) دستگاه عصبي مركزي و محيطي است

3) مغز كوچكي كه از گره هاي عصبي تشكيل شده است             4) تمام موارد

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:15  توسط زارع زاده  | 

سوالات تست فصل اول زیست شناسی و ازمایشگاه 2

سوالات تست فصل اول زیست شناسی و ازمایشگاه 2

1-در پديده ي آلرژي، كدام واكنش مقدم بر سايرين است؟ (سراسري 82)

1)آسيب ديدن و متورم شدن سلول                  2)تركيب آنتي ژن ـ آنتي بادي در سطح سلول.

3)ترشح شدن هيستامين از سلول                               4)تغيير نفوذپذيري غشاي پلاسمائي سلول.

 

2-در ايمني هومورال كدام نقش ندارد؟ (سراسري 82)

1)سلول T خاطره 2)پادتن               3)پلاسموسيت                   4)لنفوسيت B 

3-اتصال آلرژن به كدام، سبب ترشح هيستامين مي شود؟ (سراسري 83)

1)گيرنده هاي سطح لنفوسيت هاي B                                      2)پادتن هاي سطح پلاسموسيت ها

3)پادتن هاي سطح ماستوسيت ها                                           4)گيرنده هاي سطح لنفوسيت هاي T

 

4-در مراحل بروز آلرژي، كدام سلول پادتن توليد مي كند و اين پادتن ها به سطح كدام سلول مي چسبند تا هيستامين آزاد و علائم آلرژي بروز كند؟ (آزاد 82)

1)ماستوسيت ـ اريتروسيت.                                                 2)پلاسموسيت ـ ماستوسيت.

3)پلاكت ـ پلاسموسيت.                                                      4)اريتروسيت ـ ماكروفاژ.

 

5-در كدام اندام لنفي تارهاي پيوندي و سلول هاي مادر وجود دارند كه منشأ گلبول هاي سفيد و قرمز خون هستند؟ (آزاد 82)

1)مغز استخوان               2)لوزه ها                        3)طحال              4)آپانديس

 

6-سلول هاي ايمني متحرك در بدن انسان كه شامل انواعي از گلبول هاي سفيد خون مي باشند، كدام گزينه نمونه اي از آن ها هستند؟ (آزاد 82)

1)سلول هاي گره هاي لنفاوي و لنفوسيت ها                             2)نوتروفيل ها و مونوسيت ها

3)سلول هاي طحال و گره هاي لنفاوي                                                4)ماكروفاژها و سلول هاي طحال

 

7-در بيماري اسكلروزيس متعدد ( MS ) ، دستگاه ايمني، پوشش اطراف كدام سلول ها را مورد تهاجم قرار داده و در فعاليت آن ها اختلال ايجاد مي كند؟ (آزاد 82)

1)پيوندي                       2)غضروفي                     3)استخواني                     4)عصبي

8- كدام گزينه در مورد آلرژي صحيح است ؟

1) ماستوسيت ها در برخورد با آلرژن توليد پادتن مي كنند .

2) ماده آلرژن به پادتن هاي سطح ماستوسيت متصل مي شود .

3) پادتن ترشح شده در برابر آلرژن سبب بروز علايم آلرژي مي شود .

4) پلاسموسيت ها توليد هيستامين مي كنند .

 

9- به طور معمول كدام يك از انواع گلبول هاي سفيد ترشح مولكول هاي پروتئين از نوع گلبولين ها را به عهده دارد؟

1) لنفوسيت هايB              2) لنفوسيت هايT             3) گرانولوسيت ها         4) مونوسيت ها

 

10- تخريب و حل كردن ديواره سلولي ميكروب ها به عهده كدام سلول ها است؟

1) لنفوسيت هايB              2 ) لنفوسيت هايT          3) گرانولوسيت ها        4) مونوسيت ها

 

11- در مقابله با عفونت هاي باكتريايي كدام يك مهم تر است؟

1) ايمني سلولي                2) ايمني هومورال 3) لنفوسيت هاي T      4) ماكروفاژها

 

12- پلاسموسيت ها از چه سلول هايي به وجود مي آيند؟

1) مونوسيت                     2) گرانولوسيت                 3) لنفوسيت    T         4) لنفوسيت B

 

13- منشأ لنفوسيتT كدام است؟

1) تيموس                          2) مغز استخوان  3) سلول مادر              4) طحال

 

14- در عمل فاگوسيتوز كدام يك مستقيماً دخالت ندارد؟

1) غشاي سلول                   2) دستگاه گلژي               3 ) وزيكول                 4) ليزوزوم

 

15- انتقال پادزهرها از مادر به جنين چه نوع ايمني است؟

1) غير فعال                       2) فعال                            3) ذاتي                     4) غيراختصاصي

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:9  توسط زارع زاده  | 

سوالات تست فصل ششم زيست پيش دانشگاهي

سوالات تست فصل ششم زيست پيش دانشگاهي


 

 

 

1-كدام يك در تعيين اندازه جمعيت نقش مستقيم ندارد؟   

     الف- تولد      ب- مهاجرت     ج- جهش      د- مرگ

 

2- كدام يك جزء جمعيت هاي فرصت طلب نمي باشد؟   

   الف- پشه       ب- مورچه بالدار       ج- قورباغه    د- مگس

 

3- آهنگ رشد طبيعي يك جمعيت 200 تايي گوسفند ، برابر با 0.1 در سال است. جمعيت اين گله پس از دوسال با آهنگ رشد ثابت چقدر خواهد شد؟

   الف- 240            ب- 136           ج- 242              د- 168

 

4- در يك جمعيت 200 گوسفندي در طول يك سال ، 4مرگ و 8تولد، رخ داده است . آهنگ افزايش ذاتي طبيعي اين جمعيت چقدر است؟     

    الف- 0.04         ب- 0.02          ج- 0.01-            د- 0.02-

 

5- آهنگ رشد طبيعي جمعيت به ما امكان محاسبه و پيش بيني كدام يك از ويژگي هاي يك جمعيت را مي دهد؟

    الف- تراكم         ب- اندازه         ج- پراكنش           د- هر سه

 

6- وقوع كدام يك از آهنگ هاي رشد طبيعي در يك جمعيت نسبتاً كوچك بر احتمال آميزش ميان خويشاوندان مي افزايد؟

    الف- (0.1-)       ب- صفر          ج- (0.1)               د-( 0.11)

 

 

7- اثر انتخاب طبيعي بر جمعيت هاي تعادلي ………. و بر جمعيت هاي فرصت طلب……….مي باشد.

الف- تصادفي-تصادفي                  ب-تصادفي-غير تصادفي                     

  ج- غير تصادفي -  تصادفي           د-غير تصادفي-غير تصادفي

 

8-تنها وسيله دفاعي جمعيت هاي فرصت طلب در برابر تغييرات شديد و غير قابل پيش بيني محيط چيست؟

   الف- توليد زاده هاي سازگارتر           ب- ذخيره كردن غذا        

   ج- توليد مثل بيشتر                        د- همه موارد

 

9- نوتركيبي به عنوان عملي در ايجاد تنوع ژنتيكي ، در كدام جمعيت ها عاملي در ايجاد سازگاري در افراد محسوب نمي شود؟

    الف- مگس           ب- عقاب         ج- مار             د- لامپري

 

10- نوع تكامل همراه در رابطه كدام دو گونه زير با بقيه متفاوت است؟

   الف- عنكبوت و مگس                        ب- موش و گربه       

   ج- كرم قلاب دار و گوسفند                  د- مار و قورباغه

 

11- كدام يك توان بقاي جمعيت را افزايش مي دهد؟

  الف- خود لقاحي       ب-  اندازه كم        ج- جهش        د- رانش

 

12- تكامل همراه بين كدام دو جاندار وجود ندارد؟

    الف- وال  و اسب    ب- ريزوبيوم و لوبيا        ج- سگ و گربه     د- ببر و گوزن

 

13- در چه صورتي اندازه جمعيت در واحد زمان كاهش مي يابد؟ 

  الف- B>D          ب-D> r            ج-  B=D          د- B-D<0

 

14-رابطه گل شب  بو ونوزاد پروانه كلم چگونه است؟

   الف – صيادي      ب- همياري          ج- همسفرگي         د- رابطه اي ندارند

 

15- احتمال كدام يك در جمعيت هاي كوچك بيشتر است؟  

  الف-  سازش    ب- همگرايي        ج- جهش    د- نو تركيبي

 

16- در كدام حالت در جمعيت رقابت كمتري وجود دارد؟               

   الف- N=K     ب- N>K  

  ج- N د- در هر سه حالت رقابت در شديدترين حالت ممكن است.

 

17- كدام شاخص جمعيت مستقل از افراد است؟

    الف- اندازه          ب- تراكم          ج- پراكنش            د- هيچكدام

 

18- مهمترين جنبه مقايسه جمعيت هاي فرصت طلب و تعادلي كدام است؟

    الف- نوع اثري است كه محيط بر آنها دارد.          

    ب- نوع اثري است كه بر محيط دارند.

    ج- نوع اثري است كه انتخاب طبیعی بر آنها دارد.      

    د- نوع رابطه جانداران با همديگر است.

 

9 1 - كداميك از ويژگي هاي جمعيت فرصت طلب نمي باشد ؟

        الف- داراي رقابت شديد                          ب- رشد و نمو سريع       

         ج- مرگ و مير تصادفي                        د- جثه ي كوچك

 

20- كداميك از ويژگي هاي جمعيت تعادلي است?  

         الف- زاد آوري سريع                           ب-  عمر نسبتا طولاني                           

         ج- داشتن زاده ي زياد                        د-  مرگ و مير مستقل
+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:4  توسط زارع زاده  | 

سوالات تست فصل پنجم زیست شناسی پیش دانشگاهی

 

 

1- كداميك از شرايط لازم براي حفظ تعادل هاردي و اينبرگ در جمعيتها نمي باشد؟

1- آميزشهاي تصادفي       2- توقف جهش   

3- توقف شارش ژن          4- فعال بودن انتخاب طبيعي

 

2- اگر شرايط به نفع هر دو فنوتيپ افراطي باشد، ................ و اگر شرايط به نفع يكي از فنوتيپ هاي آستانه اي باشد ..................... صورت مي گيرد.

1- انتخاب گسلنده – انتخاب پايدار كننده                    2- انتخاب جهت دار – انتخاب گسلنده

3- انتخاب پايدار كننده – انتخاب گسلنده                    4- انتخاب گسلنده – انتخاب جهت دار

 

3- اگر فراواني الل كم خوني داسي شكل در منطقه اي مالارياخيز 2/0 باشد چه نسبتي از افراد جمعيت زناني با شايستگي تكاملي 1 خواهند بود؟

1- 32%           2- 64%                        3- 16%                        4- 4%

 

5- پديده هاي نوتركيبي و كراسينگ اوور به ترتيب در ................... و ..................... صورت مي گيرند.

1- ميوز I و ميوز I     2- ميوز I و ميوز II    3- ميوز II و ميوز II         4- ميوز II و ميوز I

 

6- اگر در يك جمعيت آميزشها به صورت خود لقاحي صورت بگيرد چه نتيجه اي در پي خواهد داشت؟ كاهش فراواني ...................

1- الل غالب                    2- الل مغلوب      3- افراد خالص    4- افراد ناخالص

 

7- اگر از هر 10 مرد در يك جمعيت 1 نفر به بيماري هموفيلي مبتلا باشد چه نسبتي از زنان اين جمعيت ناقل اين بيماري خواهند بود؟

1- 9%                         2- 18%                        3- 5/4%           4- 5/40%

 

جمعيتي به صورت (100AA+400Aa+250aa) را در نظر گرفته و به دو سوال زير پاسخ دهيد.

8- اگر شايستگي تكاملي افراد داراي فنوتيپ مغلوب 4/0 باشد، فراواني الل غالب پس از تاثير انتخاب طبيعي چقدر خواهد بود؟

1- 57/0              2- 43/0                3- 5/0            4- 4/0

 

9- اگر جمعيت فوق در نسل بعد داراي 1000 عضو باشد، چه تعدادي از افراد جمعيت داراي ژنوتيپ Aa خواهند شد؟

1- 400                        2- 200                         3- 500                         4- 250

 

10- اگر در جمعيتي از گلهاي ميموني فراواني الل ايجاد كننده رنگ قرمز 2/0 باشد پس از چند دور خود لقاحي فراواني گلهاي قرمز رنگ دو برابر گلهاي صورتي رنگ خواهد بود؟

1- 1                             2- 2                 3- 3                 4- 4

 

11- الل كدام بيماري سريعتر از جمعيت حذف مي شود؟

1- كم خوني داسي شكل                 2- هانتيگتون                 

3- زالي                                     4- فنيل كتونوري

 

12- كداميك حالتي از انتخاب متوازن مي باشد؟

1- افزايش تنوع در اثر كراسينگ اوور                                

2- ايجاد گامتهاي نوتركيب

3- حفظ فراواني الل كم خوني داسي شكل در منطقه مالارياخيز

4- عدم تغيير خرچنگ نعل اسبي

 

13- در گونه زايي دگرميهني تاثير كداميك بر بقيه تقدم دارد؟

1- رانش ژن       2- انتخاب طبيعي          3- جهش                4- توقف شارش ژن

 

14- اگر ژن خود ناسازگار در شبدر 4 اللي باشد چند نوع ژنوتيپ در رويان هاي اين گياه قابل مشاهده است؟

1- 4                             2- 6                 3- 15                           4- 5

 

15- يكدست كروموزوم در گياه تريپلوئيد گل مغربي ................. كروموزوم ................... مي باشد.

1- 7 – غير همتا                         2- 7- همتا         3- 3 – همتا                   4- 3 – غير همتا

 

16- در گونه زايي دگر ميهني كداميك در افزايش تفاوت ميان دو جمعيت نقشي ندارد؟

1- شارش ژن                  2- جهش            3- انتخاب طبيعي              4- رانش ژن

 

17- كداميك ممكن است منجر به گونه زايي هم ميهني شود؟

1- انتخاب جهت دار          2- انتخاب گسلنده 3- انتخاب متوازن   4- انتخاب پايدار كننده

 

18- كداميك در گذشته نزديكتري از نياي مشترك اشتقاق پيدا كرده است؟

1- موش                        2- مرغ              3- قورباغه                     4- لامپري

 

19- وجود جانداران حد واسط و انقلابهاي طبيعي بترتيب با كدام الگوي تغيير گونه ها مطابقت دارد؟

1- تعادل نقطه اي – تغيير تدريجي                            2- تعادل نقطه اي – تعادل نقطه اي

3- تغيير تدريجي – تعادل نقطه اي                            4- تغيير تدريجي – تغيير تدريجي

20- در نظريه تركيبي انتخاب طبيعي كداميك به عنوان عامل گوناگوني ژني در جمعيت در نظر گرفته نشده است؟

1- جدا شدن كروموزوم هاي همتا در مرحله آنافاز I   

۲- تصادفي بودن تركيب سلولهاي جنسي نر و ماده

3- جهش هاي كروموزومي و جهش هاي نقطه اي                  

4- مبادله قطعه بين كروماتيدهاي خواهري بهنگام ميوز

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 10:1  توسط زارع زاده  | 

سوالات تست فصل چهارم زیست شناسی پیش دانشگاهی

1-در چرخه ي زندگي يك سلول يوكاريوتي، وقتي مرحله ي ميتوز به پايان مي رسد، معمولاً كدام مرحله آغاز مي شود؟ (آزاد83)

1-  سنتز

2- نخستين مرحله ي رشد

3- سيتوكينز

4- دومين مرحله ي رشد

 

2-كدام ماده اجزائي دارد كه، باعث ساخته شدن كپسول در باكتري هاي بدون كپسول استرپتوكوكوس نومونيا مي شود؟ (پزشكي 82)

1- ريبونوكلئيك اسيد

2- اينترفرون

3- دئوكسي ريبونوكلئيك اسيد

4- اپي نفرين

 

3-باز مكمل آدنين، در مولكول DNA و در مولكول RNA به ترتيب كدام دو باز هستند؟ (آزاد82)

1- گوانين و تيمين

2- تيمين و اوراسيل

3- اوراسيل و سيتوزين

4- سيتوزين و گوانين

 

4-شكل زير كه مرحله سيتوكينز چرخه ي سلولي را نشان مي دهد، در ارتباط با كدام گزينه است؟ (آزاد 82)

1- سلول جانوري

2- استرپتوكوكوس نومونيا

3- اريتروسيت

4- سلول گياهي

 

5- در كداميك از سلولهاي زير  دو راهي همانند سازي در يك نقطه ي خاص بوجود مي آيد ؟

1- استرپتوكوكوس          

2- سلول موش                   

3- سلول نخود فرنگي        

 4- سلول انسان     

 

6- گزينه صحيح را انتخاب كنيد .

1- DNA پليمراز فقط خاصيت پليمرازي دارد .      

 2- باكتريها فقط يك دوراهي همانند سازي ايجاد مي كنند .

3- خاصيت ويرايش DNA پليمراز از بروز اشتباهات بيشتر در همانند سازي جلو گيري مي كند .

4-          كروموزوم هاي انسان هنگام همانند سازي معمولا دو دوراهي همانند سازي ايجاد مي كنند .

 

7- ضمن ترانسفورماسيون در ديپلوكوكوس كدام پديده اتفاق مي افتد ؟ 

1- انتقال كپسول به باكتري بي كپسول            

 2- انتقال ماده ژنتيكي از باكتري كپسول دار به بي كپسول

3- جهش در عدهاي از ژنهاي مسئول تشكيل كپسول 

 4- كراسينگ اور بين باكتري هاي كپسول دار و بي كپسول

 

8- اگر تعداد نوكلئوتيدهاي آدنين دار در يك نوع DNA که دارای 120 نوکلئوتید

است30 نوکلئوتید  باشد  تعداد پیوندهای هیدروژنی  در این مولکول کدام است؟

1- 60                         

 2 – 120                       

 3 - 150                       

 4- 240

 

9- هنگام همانندسازی کدام پیوندها شکسته و کدام پیوندها تشکیل می شوند؟

1- هیدروژنی – هیدروژنی            

2- هیدروژنی – هیدروژنی و فسفودی استری

3- فسفو دی استری- هیدروزنی و فسفو دی استری     

4- فسفوداستری- هیدروژنی

 

10- چنانچه در بخشی از DNA فرضي 20% نوكلئوتیدها سیتوزین دار باشد. نسبت نوکلئوتیدهای پورین کدام است؟

1- 25%                             2- 30%                               3- 50%                                    4-60%

 

11- هنگام همانند سازی قسمتی از DNAفرضی با توالی ACGTTC چند پیوند فسفات پر انرژی در نوکلئوتیدهای جدید شکسته خواهد شد؟

1- 6                             2- 12                         3- 13                          4- 24

 

12- اختلاف ATP با نوکلئوتید آدنین دار اسیدهای نوکلئیک در این است که اولی ..............

1-  باز آلی بیشتر از دومی دارد.                 

2- فسفات کمتر از دومی دارد.

3- دوفسفات بیشتر از دومی دارد.               

4- قند ریبوزدارد.

 

13- گسستگی کدام نوع از پیوندها سبب گسستگی در هر زنجیره مولکول DNA میشود؟

1- بازآلی - فسفات           

2- فسفات – قند              

3- قند – باز آلی

4- هیدروژنی

 

14- اگر مولکول DNAدارای 300 جفت باز باشدچند گروه فسفات در مولکول DNA مشاهده می شود؟

1- 150                         2- 300             3- 450             4- 600

 

15- فراوانی A در یک رشته DNA 20% و در رشته دیگر 26% است. فراوانی C در مولکول DNA چقدر خواهد بود؟

1- 4%                          2- 14%                        3- 23%                        4- 27%

 

16- كدام رابطه زير در مقايسه DNA جانداران مختلف صحيح است؟

1-  A/Gدر تمام DNA ها يكسان است .                  

2- A+C/G+T در تمام DNA  ها يكسان است .

3- A+T/G+C در تمام DNA ها يكسان است.          

4- G/T در تمام DNA  ها يكسان است.

17- در يك مولكول DNA نوكلئوتيد آدنين دار 15% است تعداد نوكلئوتيد هاي گوانین دار آن چند درصد است؟

1- 15%                      2- 30%                        3- 35%                            4- 85%

18- در يك زنجيره DNA اتصال نوكلئوتيد ها با يكديگر چگونه صورت مي گيرد؟

1- باز- باز                                        2- قند – باز                   

  3- فسفات – قند                                           4- باز – فسفات 

19-اگر در قسمتي از DNA  32 نوكلئوتيد باشد و تعداد نوكلئوتيد هاي

 AوC  برابر باشد هنگام همانند سازي اين بخش  نياز  به چند مولكول

 نوكلئوتيد G  است؟

1- 4                          2- 8                 3-12                4- 16

20- ژنوم باكتريها بصورت ......................... است .

1- تك رشته و خطي       2- تك رشته و حلقوي  

 3- دو رشته اي و حلقوي       4- دو رشته و خطي

 

 

 

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 9:57  توسط زارع زاده  | 

سوالات تست فصل سوم زیست شناسی پیش دانشگاهی

سوالات تست فصل سوم زیست شناسی پیش دانشگاهی

1-سلول هاي يوكاريوتي كه فقط داراي ميتوكندري شدند و آنهايي كه كلروپلاست را دريافت كردند به ترتيب خاستگاه كدام جانداران امروزي شدند؟ (پزشكي 1383)

1)گلسنگ ها ـ مهره داران  )گياهان ـ قارچ ها              

                     )جانوران ـ جلبك ها             )اتوتروف ها ـ هتروتروف ها

 

2-اولين مهره داراني كه در اقيانوس ها به وجود آمدند و نخستين مهره داراني كه از دريا بيرون آمدند به ترتيب كدام جانوران هستند؟ (پزشكي 1383)

1)ماهي هاي بدون آرواره ـ دوزيستان اوليه                             )دوزيستان اوليه ـ خزندگان

3)ماهي هاي بدون آرواره ـ خزندگان                         )دوزيستان اوليه ـ دوزيستان امروزي

 

3-كدام جانداران به طور همزمان در حدود ميليون ها سال پيش زندگي خود را در سطح خشكي هاي زمين آغاز كردند؟ (پزشكي 1382 )

1)ماهي هاي فاقد آرواره و دوزيستان اوليه      )جلبك ها و قارچ ها            

                     )زيگوميست ها و آسكوميست ها                     )دوزيستان اوليه و خزندگان

 

4-جو زمين در آغاز فاقد كدام گاز بوده، بعد از آن به وسيله ي كدام جانداران در جو زمين ساخته شده است؟ (آزاد 1383)

1)هيدروژن ـ گلسنگ ها    )نيتروژن ـ كپك پني سيلين   

)متان ـ جلبك هاي سبز      )اكسيژن ـ سيانوباكتري ها

 

5-بقاي حيات به وسيله ي كدام گزينه در خشكي ها تضمين شده است؟ (آزاد 1383)

1)تبديل ميكروسفرها به سلول ها                             )جلبك هاي خشكي و قارچ ها كه زندگي خود را در سطح زمين آغاز كردند.

3)پيدايش لايه اوزون در اتمسفر فوقاني                      )حشرات كه يكي از اولين ساكنان خشكي بودند.

 

6-موفق ترين مهره داران زنده كه بيش از نصف گونه هاي مهره دار را به اختصاص مي دهند، كدام جانوران هستند؟ (آزاد 1382)

1)ماهيها                                   دوزيستان                         )پرندگان                          )پستانداران

 

7-  در دستگاه ميلر پس از پايان آزمايش، كداميك از تركيبات زير ديده نمي شد ؟

1 (كربوهيدراتها                  2 (نوكلئوتيدها                   3(اسيدهاي چرب                 4(آمينو اسيدها

 

8-  كدام مولكول زيربناي اولين تركيبات آلي در مراحل ابتداي تشكيل حيات مي‏باشد ؟

۱)متان                (۲      آمونياك                       نیتروژن                اسيدآمينه

 

9- قديمي‏ترين و اولين گروه جانداران كه در سطح زمين تشكيل شده‏اند، كدام‏اند ؟

1(يوكاريوت هوازي                                  2(پروكاريوت اتوتروف                    

3(پروكاريوت هتروتروف هوازي                          4( پروكاريوت هتروتروف بي‏هوازي

 

     10 - كداميك از موارد زير در ارتباط با پيدايش يوكاريوت هوازي تأييدي بر نظرية درون همزيستي است ؟

 ۱(ژنوم خطي ميتوكندري  (۲                                  نوع تقسيم ميتوكندري    

   (3اندازه و ساختار كلروپلاست  ۴(                          ريبوزوم هاي كلروپلاست

 

11-  مخرب‏ترين انقراض گروهي كدام انقراض است ؟

1(انقراض اول      2(انقراض دوم                         3)انقراض سوم                        4)انقراض چهارم

 

   12-  دايناسورها در كدام انقراض گروهي از بين رفتند ؟                                       

1)دومين انقراض   2)سومين انقراض                     3)چهارمين انقراض                  4)پنجمين انقراض

 

13- اولين جانوراني كه از دريا به خشكي آمدند، كدام بودند ؟

1)بندپايان             2)مهره داران                          3)ماهي‏هاي فاقد آرواره              4)ماهي‏هاي دوتنفسي

 

 14- فراوان‏ترين و متنوع‏ترين گروه جانوران ساكن خشكي كدامند ؟

1)عنكبوتيان         2)حشرات                              3)عقربها                               4)رطيل‏ها

 

15-  موفق‏ترين مهره‏داران زنده ……… هستند .

1)ماهي‏ها             2)دوزيستان                    3)پرندگان                   4)پستانداران

 

 16-  اولين مهره‏داران عبارتند از :    

1)ماهي‏هاي آرواره‏دار     2 ) ماهي‏هاي بدون‏آرواره    3)ماهي‏هاي دوتنفسي         4)ماهي‏هاي غضروفي

 

 17-  كداميك از عوامل موفقيت خزندگان نسبت به دوزيستان در خشكي نمي‏باشد ؟

1) داشتن پوستة محافظ در اطراف تخم                                 2) داشتن پوست ضد آب       

3)داشتن لقاح داخلي                                           4)تعداد تخم كمتر

 

18-گسترش حیات به خشکی به کدام علت بوده است؟

1)پیدایش لایه اوزون                                      2)پیدایش اتوتروفها

3)پیدایش سیانوباکترها                                     4)پیدایش فرایند فتوسنتز

 

  19 خزندگان از تكامل كدام بوجود آمده‏اند ؟

1)ماهي‏هاي دوتنفسي                 2)دوزيستان       3)پرندگان                                4)پستانداران

 

 20-  كدام عامل باعث شد تا خزندگان كوچكتر، پستانداران و پرندگان به بقاي خود ادامه دهند ؟

1)تبديل آب و هواي خشك به مرطوب                    2)جابجايي قاره‏ها                                      

3)كم شدن غذا                                                 4)انقراض دايناسورها

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 9:53  توسط زارع زاده  | 

سوالات تست فصل چهارم زیست شناسی و آزمایشگاه 1

سوالات تست فصل چهارم زیست شناسی و آزمایشگاه 1

 

1- چينه دان پرندگان، از تغيير شكل كدام اندام حاصل مي شود؟

د) معده

ج) مري

ب) حنجره

الف) حلق

2- ترتيب صحيح عبور غذا در قسمتي از دستگاه گوارش پرندگان، كدام است؟

الف) چينه دان- معده ترشح كننده- سنگدان  

ب) چينه دان- سنگدان- معده ترشح كننده 

ج) سنگدان- چينه دان- معده ترشح كننده

د) سنگدان- معده ترشح كننده- چينه دان

3- قسمتي از معده گاو كه به روده متصل مي شود، چه نام دارد؟

د) هزارلا

ج) نگاري

ب) شيردان  

الف) سيرابي

4- سه عمل مهم اسيد معده عبارتند از:

الف) كمك به هضم غذا، ضد عفوني كردن غذا، فعال كردن پپسين

ب) كمك به هضم غذا، هضم چربيها، ضد عفوني كردن غذا

ج) هضم چربيها، ضد عفوني كردن غذا، فعال كردن پپسين

د) هضم مواد نشاسته اي، ضد عفوني كردن غذا، فعال كردن ليپاز

5- از اثر آميلاز لوزالمعده بر نشاسته، كدام قند حاصل مي شود؟

د) مالتوز

ج) گلوكز

ب) فروكتوز

الف) ساكارز

6- اسفنگتر (دريچه) پيلور در كجا واقع است؟

د) انتهاي روده باريك

ج) انتهاي دوازدهه

ب) ابتداي روده باريك  

الف) ابتداي معده

7- كدام يك به كمك انتقال فعال، جذب شبكه خوني ديواره روده مي شود؟

د) يون آهن

ج) اغلب ويتامين ها

ب) اسيد چرب

الف) فنيل آلانين

8- در جذب كدام ويتامين، ترشحات لوزالمعده موثر است؟

د) C

ج)B12

ب) B1

الف) A

9- سلولهاي كدام، گاسترين ترشح مي كنند؟

د) كبد

ج) غدد درون لوزالمعده

ب) ابتداي روده باريك 

الف) معده

10- سلولهاي كناري غدد معدي، براي جذب كدام ويتامين اهميت دارند؟

د) B12

ج) B6

ب) B2

الف) B1

11- در دگرديسي قورباغه رشد كدام اندام از سايرين كمتر است؟

د) روده 

ج) شش

ب) قلب 

الف) كبد

12- جدار روده بزرگ قابليت جذب كدام ماده را ندارد؟

د) املاح

ج) ويتامينK

ب) گلوكز

الف) آب

13- صفرا به جذب كدام ماده كمك مي كند؟

د) يونها

ج) ويتامين D

ب) قندهاي ساده 

الف) ويتامين B12

14- هورمون گاسترين از كجا توليد و چه اثري بر حركات معده دارد؟

ب) معده- كاهش

الف) معده- افزايش

د) دوازدهه- كاهش

ج) دوازدهه- افزايش

15- مهمترين عامل در تخلية معده كدام است؟

الف) زمان و ميزان مواد غذايي مصرف شده   ج)تركيب شيميايي و حجم كيموس موجود در دوازدهه

ب) تركيب شيميايي و حجم كيموس موجود در معده       د) حجم كيموس موجود در معده

16- در هنگام عمل بلع، راه بيني توسط ………… و راه ناي توسط ………. بسته مي شود؟

ب) اپي گلوت- زبان كوچك

الف) زبان- زبان كوچك

د) زبان- اپي گلوت

ج) زبان كوچك- اپي گلوت

17- محل اصلي جذب غذا در ملخ كدام بخش لوله گوارشي است .

د) روده

ج) سنگدان

ب) معده

الف) چينه دان

18- كدم كدو مولكولهاي غذايي را بوسيله چه اندامي جذب مي كند؟

د) پوست

ج) سراسر لوله گوارش

ب) سطح دهان 

الف) روده

19- كدام عبارت صحيح است؟

الف) كليه پروتئازهاي موجود در روده، توسط لوزالمعده ترشح مي شوند.

ب) فاكتور داخلي معده، در جذب بهتر ويتامين B6 نقش دارد.

ج) آنزيم پپسين به صورت فعال، توسط سلولهاي اصلي غدد معدي ترشح مي شود.

د) مواد رنگي صفرا، از تجزيه هموگلوبين گويچه هاي قرمز مرده بوجود مي آيند.

20- ديواره روده ي انسان از سمت خارج به داخل مجرا، به ترتيب عبارت است از: (

الف) بافت پيوندي- ماهيچه حلقوي- ماهيچه طولي- لايه مخاطي

ب) بافت پيوندي- ماهيچه طولي- ماهيچه حلقوي- لايه مخاطي

ج) لايه مخاطي- ماهيچه طولي- ماهيچه حلقوي- بافت پيوندي

د) لايه مخاطي- ماهيچه حلقوي- ماهيچه طولي- بافت پيوندي

21- كدام يك، در معده ي آدمي كمترين تغيير را مي يابد؟ (سراسري 80)

د) تري گليسريد

ج) لاكتوز  

ب) كازئين

الف) گلوتن

 

 

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 9:38  توسط زارع زاده  | 

سوالات تست فصل سوم زیست شناسی وآزمایشگاه 1

سوالات تست فصل سوم زیست شناسی و آزمایشگاه 1

 

1- كداميك داراي غشاء پايه است؟

4) زردپي

3) غشاء موكوزي

2) بافت غضروفي

1) بافت خوني

2- سطح دروني رگ هاي خوني از نظر بافتي با كداميك شبيه است؟

4) سطح خانه هاي ششي

3) رباط

2) سطح خارجي پوست

1) سطح دروني روده

3- سر استخوانهاي دراز در محل مفصل چه نوع بافتي وجود دارد؟

4) پيوندي سست

3) پوششي

2) پيوندي رشته اي

1) غضروف

4- در فرد بالغ سلولهاي كدام بافت افزايش نمي يابد؟

4) پيوندي زير پوست

3) ماهيچه مخطط

2) پشتيبان عصبي

1) پوشش پوست

5- انقباض كدام ماهيچه از بقيه كندتر است؟

4) ديواره مثانه

3) بين دنده اي داخلي

2) خياطه

1) قلبي

6- سلولهاي نوروگليا سلول هاي ………… هستند كه قدرت تقسيم ………… .

2) غير عصبي- دارند

1) غيرعصبي- ندارند

4) عصبي- دارند

3) عصبي- ندارند

7- سلولهاي تشكيل دهنده كدام بافت گياهي قابليت رشد و تقسيم شدن خود را حفظ مي كنند؟

4) اسكلرانشيم

3) كلانشيم

2) تراكئيد

1) آوند چوبي

8- كداميك پروتوپلاسم زنده و فعال ندارد؟

4) عناصر آوندي

3) سلول همراه

2) كلانشيم

1) كلرانشيم

9- تار كشنده، …………… است.

2) دنباله اي از سلول اپيدرمي

1) چند سلول اپيدرمي طويل

4) دنباله اي از پارانشيم پوستي

3) چند سلول پارانشيمي طويل

10- قسمت سخت هسته زردآلو از چه نوع بافتي است؟

4) كلانشيم

3) فيبر

2) تراكئيد

1) اسكلرانشيم

11- كوتين توسط كدام بافت گياهي ساخته مي شود و واحد سازنده آن چيست؟

2) اپيدرم- اسيد آمينه 

1) اپيدرم- اسيد چرب

4) پيش پوست- اسيد چرب

3) روپوست- قندهاي ساده

12- بخش خارجي پوست در ساقه هاي جوان از چه بافتي است؟

4) كلرانشيم

3) هادي

2) اسكلرانشيم

1) پارانشيم

13- به طور معمول كدام گروه سلولها فاقد ديوارة دومين هستند؟

4) پارانشيم

3) تراكئيد

2) فيبر 

1) اسكلرانشيم

14-منشأ تشكيل ريشه هاي فرعي در لوبيا كدام است؟ (سراسري 82)

1)آندودرم                                    2)پوست                         3)روپوست                                 4)دايره ي محيطيه

15-اگر بخشي از گياه زخمي شود كدام بافت اقدام به ترميم آن مي كند؟

1)كلانشيمي                     2)اسكلرانشيمي              3)پارانشيمي                   4)هادي

16-در كدام، ماهيچه ي صاف وجود دارد؟ (سراسري 82)

1)قرنيه                           2)صلبيه                         3)شبكيه             4)عنبيه

17-ماده ي آلي كه در سطح داخلي آوندهاي چوبي رسوب مي كند و ديواره آن ها را محكم مي نمايد كدام است؟ (آزاد82)

1)ليگنين                         2)كوتين                         3)رزين              4)تانن

18-كدام نوع بافت پيوندي در انسان، سلول هاي آن از هم فاصله ي زيادي داشته و بافت پوششي پوست را به ماهيچه هاي زيرين آن پيوند مي دهد؟ (آزاد 83)

1)چربي                             2)سست                   3)خوني              4)رشته اي

19- بافت پوششي در لوله هاي نفرون،سطح دروني روده و سطح دروني مري بترتيب عبارتند از :

 1.سنگ فرشي يك لايه،مكعبي يك لايه،استوانه اي يك لايه

 2. سنگ فرشي چند لايه،استوانه اي يك لايه،مكعبي يك لايه

 3. استوانه اي يك لايه، مكعبي چند لايه،سنگ فرشي چند لايه

 4. مكعبي يك لايه،استوانه اي يك لايه،سنگ فرشي چند لايه

20- كدام ماهيچه به آهستگي منقبض و انقباض خود را بيشتر نگه مي دارد؟                                                    

 1.ماهيچه چهارسرران  2. ماهيچه مثانه         3 . ماهيچه قلبي          4. ماهيچه سه سر باز
+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 9:36  توسط زارع زاده  | 

ازمون فصل دوم زیست شناسی آزمایشگاه 1

ازمون فصل دوم زیست شناسی آزمایشگاه 1

1-در كدام، RNA وجود ندارد؟

1)شبكه ي آندوپلاسمي      2)كلروپلاست                  3)ميتوكندري                   4)ريبوزوم

 2- ناحيه نوكلئوتيدي در كدام سلول ديده مي شود؟

 1)سلول قارچ                2)سلول خزه                    3)سلول باكتري                  4)سلول عصبي

3-در انسان، شبكه ي اندوپلاسمي صاف در كدام مورد كمترين نقش را دارد؟

1)آزاد شدن قند از كبد                                           2)توليد گليكوپروتئين هاي ترشحي

 3)توليد كلسترولِ غشاي سلول                                            4)ناپديد شدن صفحه ي هنسن

 4-در كدام دو اندامك كه غشاء دار مي باشند، در يكي هورمون هاي استروئيدي ساخته مي شودو در ديگري هيدروژن پراكسيد توليد مي گردد كه براي سلول سمي است؟ 

1)ريبوزوم ـ جسم گلژي                                        2)سانتريول ـ ليزوزوم

 3)پراكسي زوم ـ ريبوزوم                                     4)شبكه ي اندوپلاسمي ـ پراكسي زوم

5-در كدام بخش سلول جانوري پروتئين ساخته نمي شود؟

1)هسته                         2)كلروپلاست                  3)سيتوپلاسم                    4)ميتوكندري

6-در سلول گياهي بالغ كدام اندامك بزرگتر است؟

1)هسته                         2)كلروپلاست                  3)واكوئول                                  4)پراكسي زوم

7-در سلول هاي يوكاريوتي كدام گزينه از اندامك ها غشاء دار مي باشند؟

1)ميتوكندري و ريبوزوم   2)ريبوزوم و شبكه اندوپلاسمي  3)ليزوزوم و پراكسي زوم          4)ميكروتوبول و ريز رشته.

8-در سلول یوکاریوتی و پروکاریوتی به ترتيب در چند محل عمل پروتئين سازي انجام مي شود؟

1) 1 و 1                       2) 2 و 3                                     3) 4 و 1                                   4) 2 و 2

9-در سلول هاي كدام غده، شبكه ي اندوپلاسمي صاف نقش بيش تري دارد؟

1)هيپوفيز                                  2)لوزالمعده                     3)تخمدان ها                    4)بخش مركزي غده ي فوق كليوي

10 - قدرت جداسازي ميكروسكوپ ها به كدام عامل بستگي بيشتري دارد؟

4) طول موج تابشي

3) ديافراگم

2) بزرگنمايي عدسي

1) نوع عدسي

11- كداميك با ميكروسكوپ نوري قابل مشاهده نيست؟

5) هسته

4) ريبوزوم

3) ميتوكندري

1) باكتري

12- كداميك از موارد زير با ميكروسكوپ الكتروني قابل مشاهده نيست؟

4) اتم هاي تشكيل دهنده پروتئين

3) فسفوليپيد

2) ريبوزوم

1) ويروس

13- شكل هر سلول به چه عاملي بستگي دارد؟

4) محل استقرار

3) نوع جاندار

2) عمل

1) اندازه

14- كداميك در همه باكتريها وجود دارد؟

4) ريبوزوم

3) تاژك

2) هسته

1) كپسول

15- كداميك اندامك غشاءدار نيست؟

4) جسم گلژي

3) واكوئل

2) ميتوكندري

1) ميكروتوبول

16- در سلولهاي بدن كداميك سانتريول وجود ندارد؟

4) خزه و سرو

3) سرخس و كاج

2) سرو و كاج

1) سرخس و خزه

17- واحدهاي سازنده مولكولي كه انتقال گلوكز را به درون سلول ممكن مي سازد چيست؟

4) منوساكاريد

3) اسيد چرب

2) نوكلئوتيد

1) اسيد آمينه

18- شباهت ريبوزوم پروكاريوتها و ريبوزوم ميتوكندريها دليلي است بر:

1) نقش ريبوزوم در سنتز پروتئين

2) پيدايش ميتوكندري ها از باكتريها

3) شباهت فعاليتهاي متابوليكي در انواع سلولها

4) تكامل بيشتر يوكاريوتها نسبت به پروكاريوتها

19- شبكه آندوپلاسمي زبر و شبكه آندوپلاسمي صاف از نظر ساختار و عمل چگونه اند؟

4) متفاوت- متفاوت

3) مشابه- مشابه

2) متفاوت- مشابه

1) مشابه- متفاوت

20- سلولهاي تشكيل دهنده كداميك اجسام گلژي بيشتري دارد.

4) ماهيچه

3) لوزالمعده

2) طحال

1) كليه

21- كدام اندامك از نظر شكل و اندازه متنوعتر از سايرين است؟

4) ريبوزوم

3) جسم گلژي

2) واكوئل

1) ميتوكندري

22- كداميك به روش اندوسيتوز وارد سلول مي شود؟

4) پروتئين

3) Na+

2) گلوكز

1) اسيد آمينه

23- كداميك نسبت به تغييرات فشار اسمزي مقاوم تر است؟

4) سلولهاي پوششي روده

3) باكتري

2) پارامسي

1) گلبول قرمز

24- در چه بخشي از كلروپلاست انرژي نوراني به دام مي افتد؟

4) غشاء خارجي

3) غشاء داخلي

2) استروما

1) گرانوم

25- كدام اندامك سلول،فاقد غشاء مي باشد؟

1)جسم گلژي               2)ميتوكندري                     3)شبكه آندوپلاسمي          4)ریبوزوم

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 9:33  توسط زارع زاده  | 

سوالات چهار گزینه ای فصل 1 زیست شناسی و آز 1

سوالات چهار گزینه ای فصل 1 زیست شناسی و آز 1

 

1- درتارعنکبوت،تارهایی که درون اجسام مهره مانند قرار می گیرند........خاصیت کشسانی وازجنس.......هستند.

1- دارای- پروتئن        2-دارای- DNA          3- فاقد- پروتئن           4- فاقد-DNA

2- ایزومرها درتمام موارد زیربهم شبیه اند مگر:

1- وزن مولکولی                                           2- خواص شیمیایی

3- نوع اتمهای به کاررفته درآنها                        4- تعداد اتمها

3- ترکیباتی که دارای بنیانهای ئیدروکسیل وکربوکسیل می باشند به ترتیب چه نامیده می شوند؟

1- الکل- اسید          2- اسید- الکل              3- آمین- اسید             4- الکل- آمین

4- کدام یک ازترکیبات زیر می تواند منومرهای متنوع تری داشته باشد؟

1- پروتئین ها        2- کربوهیدراتها          3- اکسیدهای نوکلئید         4- لیپیدها

 

5- درفرایند هیدرولیزها چه ماده ای مصرف و چه ماده ای تولید می شود؟

1- منومر-H2O         2- H2O- منومر           3- پلیمر-   H2O       4   - منومر- پلیمر

6- کدام یک ازترکیبات زیر بادیگران ایزومر نیست؟

1- گلوکز             2- فروکتوز                3- ریبوز                4- گالاکتوز

7- ریبوز ودئوکسی ریبوز درتمام جهات زیر ازهم متفاوتند مگر:

1- نوع اتمهای به کاررفته درآنها                       2- وزن مولکولی

3- تعداد اتمهای موجود درآنها                            4- آرایش اتمی

8- کدامیک ازواحدهای سازنده کربوهیدراتها محسوب نمی شوند؟

1- گلوکز             2- فروکتوز              3- گالاکتوز            4- مالتوز

9- از ئیدرولیز کدام،منومر های یکسانی ایجاد می شوند؟

1- مالتوز               2- لاکتوز                3- ساکارز             4- شکر

10- قند موجود درجوانه جو چه نامیده می شود؟

1- لاکتوز            2- ساکارز               3- مالتوز            4-  فروکتوز

11- مهمترین ویژگی عمل آنزیم ها کدام است؟

1- افزایش سرعت واکنش                          2-اختصاصی بودن عمل آنها

3- تغییر در جهت واکنش                          4- تاثیر بر پیش ماده با غلظت کم

12- کدامیک از عبارات زیر نادرست است؟

1- آنزیم ها در پایان واکنش دست نخورده باقی می مانند.

2- اغلب آنزیم ها ساختار پروتئینی دارند.

3- عمل بسیاری از آنزیم های بدن ما در دمای 45 دچار اختلال می شوند.

4- نوع فعالیت هر آنزیم بستگی به غلظت آن در محیط دارد.

13- علت اختصاصی بودن آنزیم ها در چیست؟

1- جایگاه عمل                          2- ساختار سه بعدی          

     3- PHمحیط                 4- وجود ترکیبات غیر پروتئینی

14- تغییراتPHمحیط موجب:.................... آنزیم ها می شود.

1- فعال تر شدن                                  2- هیدرولیز

3- تغییر در ساختار سه بعدی                 4- تغییر در نوع فرآورده

15- آمیلاز بر چه ماده ای موثر و فرآورده آن کدامست؟

1- نشاسته- مالتوز        2 - نشاسته- گلوکز          3- مالتوز- گلوکز       4- گلیکوژن- مالتوز

16- جهت زدودن موهای روی پوست جانوران ازکدام آنزیم استفاده می شود؟

1- کاتالاز           2- پروتئاز          3- لیپاز           4- ایزومراز

17- کدام آنزیم در صنعت شکلات سازی بیشتر کاربرد دارد؟

1- آمیلاز        2- سلولاز           3- مالتاز              4- لاکتاز

18- شیرین ترین قند کدام است؟

1- گالاکتوز         2- گلوکز          3- فروکتوز            4- مالتوز

19- از کدامیک از آنزیم ها جهت تبدیل گلوکز به فروکتوز استفاده می شود؟

 

1- ساکاراز            2- مالتاز             3- کاتالاز          4- ایزومراز

20- جهت تولید اسفنج از کدام آنزیم استفاده می کنند؟

1- سلولاز            2- کاتالاز            3- پروتئاز           4- لیپاز

21- جهت تشکیل پیوند پپتیدی چه عواملی از هراسید آمینه دخالت دارند؟

1- OHکربوکسیل از 2اسیدآمینه مجاور باهم

2- Hعامل آمینی یک اسید آمینه باOHکربوکسیل اسید آمینه قبل از خود

3- Hعامل آمینی از2اسید آمینه مجاور هم

4- Hعامل آمینی یک اسید آمینه با-C=Oاسید آمینه مجاور

22- درابتدا وانتهای ملکول پپتیدی چه گروههایی وجود دارند؟

1- NH2(ابتدا)- COOH                     2- COOH(ابتدا)- NH2

3- کربوکسیل- ئیدروکسیل                    4- آمین- ئیدروکسیل

23- ازبه هم پیوستن 23اسید آمینه چند مولکول آب آزاد وچند پیوند پپتیدی تشکیل می شود؟ به ترتیب از راست:

1- 23_ 22            2- 23_22           3- 22_23         4- 22_22

24- درساده ترین اسید آمینه بجای Rکدامیک قرار می گیرند؟

1-  H               2-    CH3                3-   NH2             4-   C-NH2

25- کدام واکنش انرژی خواه است؟

1- اسید اسیون گلوکز                                   2- تولید آنزیم درسلول

3- تبدیل گلوکز به الکل                                4- تجزیه چربیها

26- جهت ئیدرولیز کامل کدامیک نیاز به ملکولهای آب بیشتری است؟

1- تری پپتید        2- فسفولیپید           3- ساکارز        4- لاکتوز

27- آدنوزین واجد همه ترکیبات زیر است بجز:

1- گروه فسفات         2- نیتروژن            3- آدنین           4- پنتوز

28- کدام واکنش درست است؟

1- انرژی + P + ATP + H2O >ATP

2- انرژی +  ATP + H2O > ADP + P  

3- انرژی +P + ATP > H2O  

4-ADP +H2O + P  < انرژی +ATP

29- ATPدارای..........پیوند غنی از انرژی بین..........است.

1- 3_قند وفسفات                        2- 2_قند و فسفات   

   3- 3_گروههای فسفات                    4- 2_گروههای فسفات

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 9:29  توسط زارع زاده  | 

ازمون تست فصل اول زیست شناسی وآزمایشگاه 1

 

 ازمون تست فصل اول زیست شناسی وآزمایشگاه 1

1-            منومرها در كداميك متنوع تر است؟

4) كربوهيدرات

3) اسيدهاي نوكلئيك

2) پروتئين

1) ليپيد

2-            در فرآيند هيدروليز ………… مصرف و …………… توليد مي شود.

4) H2O – پلي مر

3) H2O – منومر

2) پلي مر- H2O

1) منومر- H2O

3-            از هيدروليز كدام، منومرهاي يكسان حاصل مي شود؟

4) گالاكتوز

3) ساكاروز

2) لاكتوز

1) مالتوز

4-            گليكوژن و نشاسته از چه جهت به هم شبيه هستند؟

4) واحد سازنده

3) مكان توليد

2) وزن مولكولي

1) تعداد انشعاب

5-            بيشترين تركيب آلي طبيعت كدام است؟

4) گليكوژن

3) سلولز

2) DNA

1) گلوكز

6-            در تشكيل تري گليسريد چند مولكول گليسرول شركت كرده و چند مولكول آب آزاد مي شود؟ (به ترتيب از راست به چپ)

4)1و1

3) 3و1

2) 1و3

1) 3و3

7-            بخش عمده غشاء هاي زيستي از ………… است.

4) فسفوليپيد

3) گليكوپروتئين

2) كربوهيدرات

1) استروئيد

8-            در ساختار كداميك، اسيد چرب وجود ندارد؟

4) كوتين

3) تري گليسيريد

2) فسفوليپيد

1) هورمون هاي جنسي

9-            در ساختار فسفوليپيدها ………… مولكول اسيد چرب و ………… . مولكول فسفات وجود دارد.

4) 3و1

3) 1و2

2) 2و1

1) 1و1

10-مهمترين ويژگي عمل آنزيم ها كدام است؟

2) اختصاصي بودن عمل آنها

1) افزايش سرعت واكنش

4) تأثير بر پيش ماده با غلظت كم

3) تغيير در جهت واكنش

11-تغييرات PH محيط موجب ………… آنزيم ها مي شود.

2) هيدروليز

1) فعال تر شدن

4) تغيير در نوع فرآورده

3) تغيير در ساختار سه بعدي

12- آميلاز بزاق بر چه ماده اي موثر و فرآورده آن كدام است؟

2) نشاسته- گلوكز

1) نشاسته- مالتوز

4) گليكوژن- مالتوز

3) مالتوز- گلوكز

13- منومر كداميك اسيد آمينه نيست؟

4) ساكارز

3) مالتاز

2) ليپاز

1) پروتئاز

14- از به هم پيوستن 51 اسيد آمينه، چند مولكول آب آزاد و چند پيوند پپتيدي تشكيل مي شود؟

4) 49-50

3) 51-50

2) 50-50

1) 51-51

15- كدام واكنش انرژي خواه است؟

2) توليد آنزيم در سلول

1) اكسيداسيون گلوكز

4) تجزيه چربيها

3) تبديل گلوكز به الكل

16- براي هيدروليز كامل كداميك نياز به مولكولهاي آب بيشتري است؟

4) لاكتوز

3) ساكاروز

2) فسفو ليپيد

1) تري پپتيد

17- آدنوزين واجد همه تركيبات زير است بجزء …………

4) نيتروژن

3) فسفات

2) باز آلي

1) قند 5 كربني

18-يك مولكول چربي، مجموعه اي از كدام مولكول هاست؟

1)سه اسيد چرب ـ يك گليسرول                    2)يك اسيد چرب ـ يك الكل

3)دو اسيد چرب ـ يك گليسرول                              4)سه اسيد چرب ـ يك كلسترول

19-كدام تركيب داراي پيوند پپتيدي است؟

1)اسيد ريبونوكلئيك        2) AMP حلقوي 3)اسيد دئوكسي ريبونوكلئيك                4) DNA ليگاز  

20-مونومر تشكيل دهنده ي ليپاز مشابه كدام تركيب آلي است؟

1)ميلين                  2)پادتن                               3)كوتين                                      4)گليكوژن

21-كدام يك از مولكول هاي زير در گياهان ساخته شده و سوخت اصلي سلول ها مي باشد؟

1)اسيد چرب                        2)گليكوژن              3)مالتوز                          4)گلوكز

22-ساختار كدام دو گروه از ليپيدها، تشابه بيش تري با يكديگر دارند؟

1)موم ها و فسفوليپيدها                                                 2)استروئيدها و تري گليسريدها         

 3)تري گليسريدها و فسفوليپيدها                                       4)موم ها و استروئيدها

23-مونومر سازنده ي كدام يك با بقيه تفاوت دارد؟

1)مالتوز                               2)سلولز              3)سلولاز                                     4)نشاسته

24-هر مولكول ATP ، چند پيوند غني از انرژي دارد؟

1) يك پيوند               2) دو پيوند                       3) سه پيوند                    4) چهار پيوند

 25-كدام يك، با تأثير آنزيم هاي مترشحه از سلول هاي دستگاه گوارش انسان، به واحدهاي يكساني تبديل مي شود؟ (کنکور سراسري سال 1383)

1)گليكوژن                    2)ساكارز                                    3)سلولز                          4)لاكتوز

+ نوشته شده در  دوشنبه یکم آذر 1389ساعت 9:25  توسط زارع زاده  | 

نمونه تست فصل 2 زيست پيش دانشگاهي

تست ازفصل2زیست شناسی پیش دانشگاهی

باقرارگرفتن موس برروی گزینه درست به شکل دست درمی آید.

1-ژنوم انسان شامل كدام گزينه است؟ (پزشكي 1383)

1)كل محتواي RNA يك جاندار                 2) 23 كروموزوم اتوزوم و 2 كروموزوم جنسي X و Y

3)فقط دو كروموزوم جنسي X وYو                     4) 22جفت كروموزوم غير جنسي و 2 كروموزوم جنسي

 

2-ويروس كدام بيماري باعث التهاب كبد ميشود و واكسن آن امروزه از طريق مهندسي ژنتيك ساخته شده است؟ پزشكي 1383

1)نقص ايمني اكتسابي            (HIV     2)آنفلوآنزا                             

 3)B هپاتيت                             4)فلج اطفال

 

3-باكتريوفاژ فرضي جديدي، با استفاده از كپسيد باكتريوفاژ T1و DNA باكتريوفاژ T2 حاصل شده است. با آلوده كردن باكتري ميزبان،

انتظار مي رود ويروس هاي حاصل، از كدام نوع باشند؟(سراسري 1382)

1) T1                        2) T2                                   3)هر دو نوع T1 و T2  4) DNAT2 و كپسيد T1

 

4-پلازميدها كه نوعي مولكول DNA حلقوي هستند، در درون كدام جانداران حضور دارند و مي توانند مستقل از كروموزوم

اصلي جاندار همانندسازي كنند؟ (پزشكي 1382 )

1)سياهك ها                        2)مخمرها                  3)زنگ ها                                  4)باكتري ها

 

5-ژن مورد نظر جدا شده از ژنوم را به درون باكتري، كدام مورد هدايت مي كند و از معمولترين وكتورها مي باشد؟( آزاد 1383)

1)مخمرها و آنزيم هاي محدود كننده                                       2)اوگلناها و آنزيم ليگاز

3)تاژكداران و مخمرها                                                            4)ويروس ها و پلازميدها

 

6- با تاثیر آنزیم محدود کننده بر یک DNA  حلقوی که 3 جایگاه تشخیص آنزیم دارد. به ترتیب چند پیوند فسفودی استری

می شکند و چند قطعه ایجاد می شود؟

1) 3و 3                                   2) 4 و 6                      3) 6 و 3                                  4) 3 و 4

7- در مهندسی ژنتیک برای تولید انسولین انسانی و فاکتور انعقادی شماره XIII انسانی بترتیب کدام یک ایجاد می شود؟

1) باکتری دست ورزی شده – جانور تراژنی                              2) جانور تراژنی -   جانور تراژنی

3) جانور تراژنی -  باکتری نوترکیب                 4) باکتری دست ورزی شده - باکتری دست ورزی شده

 

8- میزبان تولید هورمون رشد گاوی و پروتئین پیچیده ی انسانی در مهندسی ژنتیک به ترتیب کدامند؟

1) جانور تراژنی -   جانور تراژنی                                                2) پلازمید -   جانور تراژنی

3) باکتری - جانور تراژنی                                                           4) جانور تراژنی - باکتری

 

9-  چنانچه اگزونی با 1026 نوکلئوتید از یک ژن مسئول سنتز بخشی از اواسط رشته ی پلی پپتیدی باشد. در این قطعه

از پلی پپتید چند اسید آمینه قرار خواهد گرفت؟

1) 171                                    2) 172                   3) 512                                        4) 1542

 

10-در الکتروفورز ملکول DNA حرکت ملکولها به سمت کدام قطب بوده و کدام قطعات مسافت بیشتری را طی میکنند؟

1) مثبت – کوچکتر       2) مثبت – بزرگتر      3) منفی – کوچکتر                4) منفی – بزرگتر

 

11- در اتصال DNA  خارجی به وکتور چند پیوند فسفو دی استری باید برقرار شود؟

1) 2                       2) 4                       3) 8                                           4)10

 

12- عمل کدام آنزیم در مهندسی ژنتیک بر سایر آنزیم ها مقدم است؟

۱)  آنزیم محدود كننده     2) DNA لیگاز                    ۳) RNA پلی مراز         4) DNA پلی مراز

 

13- در مهندسی ژنتیک برای تهیه ملکولهای نوترکیب کدام آنزیم پیوند فسفو دی استری بین دو انتهای مکمل را ایجاد میکند؟

1)آنزیم محدود كننده         2) DNA لیگاز         3)هلیکاز                                   4) DNA پلی مراز

 

14- ماهیت شیمیایی کدامیک با بقیه متفاوت است؟

1) ژن                                    2) پلازمید TI   3)    RNA پلیمراز          4) RNA

 

15- کدام یک از بیماریهای زیر احتمال بروز بیشتری در مردان دارد؟

1) سیستیک فیبروزیز      2) کم خونی داسی شکل    3) نشانگان زالی – ناشنوایی    4) هانتینگتون

 

16-  در الکتروفورز ملکولها ی DNA بر چه اساسی از هم جدا میشوند؟

1) خواص شیمیایی           2) توالی نوکلئوتیدها       3) نوع نوکلئوتیدها             4) طول قطعات

 

17 كلون كردن ژن توسط كدام آنزيم انجام ميشود؟

1)DNA پليمراز        2)RNA پليمراز                          3) DNA ليگاز                             4) پروتئاز

 

18-در تهيه واكسن بر عليه ويروس هرپس ، از كدام استفاده شد؟

1)ژن بيماريزاي هرپس           2) ژن پادتن ضدهرپس

3)ژن رمز كننده پليمرازهاي هرپس       4) ژن رمز كننده پروتئين هاي سطحي هرپس

 

19-بطور معمول كدام نا هنجاري از پدر به پسر به ارث نمي رسد؟

1)  ديستروفي عضلاني         2) هانتينگتون         3) تالاسمي مينور         4) سيستيك فيبروزيس

 

20- تحت تاثير آنزيم ليگاز  بر روي جايگاه اتصال نواحي چسبنده، چند پيوند هيدروژني

 در محل اتصال تشكيل ميشود؟

1) 2                                         2)8                                 3)10                               4)16

 

21- پيوند بين منومرهاي كدام دو تركيب به هم شبيه اند:

1) ليگاز – پلازميد               2) وكتور-EcoRI

3)EcoRI - ليگاز                  4) وكتور – ليگاز

 

22- کدام یک تنظیم بیان ژن ندارد؟

1) اریترو سیت                      2) ماکرو فاژ             3 )نرون                      4) کلرو پلاست

 

23- گال به كدام اطلاق ميشود؟

1) پلازميد باكتريايي           2) القاء كننده ايجاد تومور        3) نوعي بيماري           4) وكتور

 

24- DNA ي حلقوی كه n جايگاه اثر براي آنزيم محدود كننده دارد به هنگام برش چند قطعه DNA توليد ميكند؟

1) n                          2) 2n                     3)n+1                          4) n-1

 

25 - تنظيم بيان ژن در اپرانهاي هموفيلوس آنفلو آنزا بخاطر چيست؟

1 ) نمو                                    2)تمايز                   3) سازگاري با محيط             4) هر سه مورد

+ نوشته شده در  دوشنبه سوم آبان 1389ساعت 10:28  توسط زارع زاده  | 

۴- مونومر فعال كننده و افزاينده به ترتيب كدامند ؟

     1) هر دو آمينو اسيد     2)‌ آمينو اسيد ، نوكلئوتيد    3) هر دو نوكلئوتيد      4) نوكلئوتيد ، آمينو اسيد

۵- تنظيم بيان ژن در كدام جاندار ، بعد از ترجمه هم صورت مي گيرد ؟

     1) هموفيلوس آنفلوآنزا      2) استرپتوكوكوس نومونيا    3) اشرشيا كلاي           4) نوروسپورا كراسا

۶- هرگاه قطعه ژني در آدمي داراي 538 پيوند فسفو دي استر باشد ، رشته پلي پپتيدي كه تحت رهبري آن ساخته مي شود چند پيوند پپتيدي دارد ؟

     1) 90                              2) 89                              3) 88                               4) 87

۷- كدام يك در هسته نورو گلياي آدمي داراي رمز است ؟

     1) لسيتين                       2) كوتين                          3) كراتين                          4) كيتين

۸- هرگاه توالي يك رشته DNA به صورت CGTAATGCC باشد ، ملكول mRNA اي كه از روي رشته مقابل آن رونويسي مي شود داراي چند باز پوريني است ؟

     1) 5                                2) 4                                3) 3                                4) 2

۹- هرگاه ظرف شيري را به باكتري اشرشيا کلای آلوده كنيم ، احتمال تشكيل كدام تركيب بيشتر است ؟

     1) مهار كننده – لاكتوز         2) اپراتور – مهار كننده

     3) پروتئين تنظيمي – آلولاكتوز                                    4) RNA پليمراز – اپراتور

۱۰- tRNA آغازگر به ترتيب و از راست به چپ ، از كدام جايگاه وارد ريبوزوم شده و از كدام جايگاه خارج مي گردد ؟

     1) P , A                           2) A , P                           3) A , A                           4) P , P

۱۱- عوامل رونويسي در آميب به كدام ، وصل نمي شوند ؟

     1) اپراتور                          2) توالي افزاينده                3) RNA پليمراز                  4) راه انداز

۱۲- در ترجمه RNA پيك مقابل ، اولين و آخرين آنتي كدوني كه درون جايگاه A ريبوزوم قرار مي گيرد به ترتيب و از راست به چپ كدامند ؟

--------->

----------------------------------------------------

CCUUUAAUGGCCUACGGCAUCGAUUAACCG   

     1) AUU , AAU                   2) CUA , CGG                   3) AUU , CGG                   4)‌ CUA , UAC

۱۳- تنوع محصولاتِ كدام RNA پليمراز بيشتر است ؟

     1) I                                 2) III                               3) پروكاريوتي                    4) II

۱۴- كپك نوروسپوراي غير جهش يافته قادر به ساختن كدام نمي باشد ؟

     1) فنيل اُرنیتین                  2) آرژینین                         3) بيوتين                          4) سيترولين

۱۵- در پديده رونويسي ژن، كدام مرحله از بقیه زودتر انجام می شود؟

     1) تشكيل پيوند هاي فسفودي استر                           2) شكستن پيوند هاي هيدروژني

     3) اتصال هليكاز به DNA الگو                                      4) اتصال آنزيم RNAپليمراز به دو رشته DNA

 

۱۶- اگر mRNA نابالغ در نوتروفیل داراي 3 توالي رونوشت اگزون باشد ، براي كوتاه شدن آن از راست به چپ چند پيوند فسفودي استر مي شكند و تشكيل مي شود ؟

     1) 4 و 2                           2) 6 و 3                           3) 2 و 4                           4) 3 و 6

۱۷- در انتهاي بخش رمز گردانِ ژن سازنده انواع RNA هاي ناقل کدام توالي ديده مي شود ؟

     1) CCA                            2) GGT                            3)‌ UAC                            4) GGU

۱۸- جهش در كدام يك به نسل بعد هم منتقل مي گردد ؟

    1) كروموزم x در لوزالمعده    2) كروموزم y در كبد   3) كروموزم 21 در تخمك  4) كروموزم 23 در شبكيه

۱۹- توالي راه انداز (P) داراي ....................... (جمله را کامل کنید)

     1) ريبوز بوده و رونويسي مي شود .                        2) دئوكسي ريبوز بوده و رونويسي مي شود .

     3 ) ريبوز بوده و رونويسي نمي شود .                     4) دئوكسي ريبوز بوده و رونويسي نمي شود .

۲۰- كدام آنتي كدون زير را مي توان در سلول ها يافت ؟

     1) AAC                            2) ACU                            3) AUC                              4) AUU

 

 

۲۱- براي ساخت يك رشته پلي پپتيد با n‌ آمينو اسيد ،‌ريبوزوم چند بار روي mRNA حركت مي كند ؟

     1)  n+1                         2) n                                3) n-1                          4) n+2

۲۲- RNA پليمراز III به كدام يك وصل مي شود ؟

     1) DNA دو رشته اي حلقوي 2) DNA دو رشته اي خطي

     3) DNA تك رشته اي خطي                                       4) DNA تك رشته اي حلقوي

۲۳- كدام ، در مورد عامل پايان ترجمه درست نيست ؟

     1) جنس مونومر هاي آن آمينو اسيدي است .

     2) شناسايي رمز UAA را به عهده  دارد .

     3) در جايگاه A ريبوزوم جاي مي گيرد .

     4) پيوند بين آخرين tRNA موجود در جايگاه A و پلي پپتيد را مي شكند .

۲۴- الگو برداري از ژن سازنده آنزيمِ تجزيه كننده اسيد هموجنتيسيك به عهده كدام است ؟

     1) هليكاز                                                               2) DNA پليمراز يوكاريوتي

     3) RNA پليمراز II                                                     4) RNA پليمراز I

۲۵- «مهار كننده» در كجا و توسط كدام ژن ساخته مي شود ؟

     1) سيتوپلاسم ، تنظيمي و حلقوي                             2) هسته ، ساختاري و حلقوي

     3) سيتوپلاسم ، ساختاري و خطي                             4) هسته ، تنظيمي و خطي

۲۶- در بين توالي هاي اگزون و اينترون ............. (جمله را کامل کنید)

     1) فقط دومي رو نويسي مي شود .                  2) فقط قسمتي از رونوشت اولي ترجمه مي گردد .

     3) فقط اولي رونويسي مي شود .                   4) فقط قسمتي از رونوشت دومي ترجمه مي گردد .

۲۶- تنوع مونومرهاي كدام ، بيشتر است ؟

     1) اپراتور                          2) افزاينده                    3) عامل رونويسي           4) رونوشت اينترون


 

۲۸- كدام گزينه نادرست بيان شده است ؟

     1) محل برقراري پيوند پپتيدي درجايگاه A ريبوزوم است .

     2) عمل دوبازوي tRNA كمك به نگهداري اين مولكول درون ريبوزوم است .

     3) اتصال زير واحد بزرگ ريبوزوم در انتهاي مرحله آغاز ترجمه روي مي دهد .

     4) قند پنتوز در آنتي كدون و كدون باهم متفاوت است .

 

۲۹- همه مولكول هاي tRNA ................. (جمله را کامل کنید)

     1) محصول فعاليت RNA پليمراز III هستند .

     2) در هسته ساخته مي شوند ولي در سيتوپلاسم فعالیت دارند .

     3) داراي بازوي آنتي كدونِ CCA مي باشند .

     4) در نوكلئوتيد آدنين دار انتهايي به آمينواسيد متصل مي شوند .

۳۰- توانایی انجام كدام عمل بين هليكاز و RNA پليمراز مشترك می باشد ؟

     1) شكستن پيوند هاي هيدروژني                               2) تشكيل پيوند هاي هيدروژني

            3) شكستن پيوند هاي فسفودي استر         4) تشكيل پيوند هاي فسفودي استر

+ نوشته شده در  دوشنبه سوم آبان 1389ساعت 10:22  توسط زارع زاده  | 

سوالات مسابقه آزمایشگاه زیست شناسی

سوالات مسابقات آزمایشگاهی

***سؤالات مسابقات آزمايشگاهی زيست شناسي ناحيه 5مشهد***

-------------------------------------------------------------

1-كدام يك از اجزاي ميكروسكوپي در تشكيل تصوير نقش عمده اي ندارد؟

1-منبع نور        2-اثر كتيف         3-لوله ميكروسكوپ       4-اوكولر
-------------------------------------------------------------
2-براي شروع كار با ميكروسكوپ ، بهتر است از كدام عدسي شيئ استفاده نمائيم؟

1-4                2-10                  3-40                        4-100
-------------------------------------------------------------
3-مشاهده كروموپلاستها در كدام يك به راحتي انجام ميگردد؟

1-بشره تره      2-دانه گندم         3-سيب زميني            4-ريشه هويج
-------------------------------------------------------------

4-چنانچه درآزمايش گروه خوني ، آنتي كرهاي D(ضدRHAرسوب داده باشد، گره خوني فرد كدام است؟

1-A-               2-A+               3-+B                         4-B- 
-------------------------------------------------------------

5-براي مشاهده تو‍‍‍أم بافت پارانشيم وكلانشيم ، كدام را پيشنهاد مي كنيد؟

1-مشاهده برش عرضي ساقه نعناع                

 2- مشاهده برش عرضي ساقه گياهان مسن

3-مشاهده برش طولي گياهان دولپه               

4-ممكن است اين دوبافت باهم ديده نشوند.
-------------------------------------------------------------

6-وجود 5 قوس آئورتي كه مري را دور مي زنند از اختصاصات كدام جانور است ؟

1-قورباغه         2-كرم خاكي          3-كبوتر              4-ملخ
-------------------------------------------------------------

7-در تشريح مغز چنانچه در امتدادجسم كرمينه اي برش داده شده و2نيمكرهاز هم جدا شوند،  بلافاصله در زير آن كداميك مشاهده مي شود؟

1-بطن3                             2-برجستگي هاي چهار كانه     

 3-پل مغزي                         4-بطن4
-------------------------------------------------------------

8-كدام يك كف بطن هاي جانبي را تشكيل مي دهد؟

1-جسم پينه اي         2-پايكهاي مغزي      

3-رابط 3گوش                4-تالاموس
-------------------------------------------------------------

9-كدام يك از بخشهاي زير در سطح پشتي مغز قابل مشاهده است؟

1-كرمينه                          2-كياسماي بينايي     

3-پايك هاي مغزي           4-برجستگي حلقوي
-------------------------------------------------------------

10-كدام يك از ويژگيهاي گياهان دو لپه مي باشد ؟

1-رگبرگهاي موازي                           2- ريشه راست     

3-اجزاي گل 3يا مضربي از آن   4-برگ سوزني شكل
-------------------------------------------------------------

11-در برش ميكروسكوپي ريشه ، كدام يك مشاهده نمي گردد ؟

1-پوست بيشترين بخش ريشه را تشكيل مي دهد.
2-دسته جات آوندي چوب و آبكش بصورت يك در ميان مي باشند.
3-آوندهاي چوبي قطورتر به سمت خارج قرار دارن‍‍‍د.
4-آندوردرم ، داراي نوار كاسپاري است .

 

 


-------------------------------------------------------------

12-درآزمويش مربوط به جستجوي آميلاز در ميكروبهاي خاك،‌احتمال وجود
 آميلاز در كدام نقطه بيشتر است ؟
1-
A                     2-B               

3-C                     4-D

 

 

 


 

-------------------------------------------------------------

13-ديواره سلولهاي پارانشيمي در رنگ آميزي مضاعف به چه رنگي ديده مي شوند ؟
1-قرمز          2-سبز           3-بنفش           4-آبي

14-دي اكسيدكربن موجود در هواي بازدمي محلول برم تيمول را به چه رنگي درمي آورد ؟
1-سبز         
2-زرد             3-قرمز             4-آبي

----------------------------------------------------------  

15- در اپيدرم تره ، چند نوع سلول ديده مي شود ؟

1-1              2-2               3-3                 4-4

-------------------------------------------------------------
16-كدام يك از گزينه هاي زير،نشان دهنده فعاليت عضله مستقيم داخلي چشم است؟
1-چشم راست را در جهت عقربه هاي ساعت مي گرداند.
2-كره  چشم را به طرف خارج مي گرداند .
3-چشم راست را مخالف مورب بالايي مي گرداند .
4-كره چشم را به طرف بيني مي گرداند.
-------------------------------------------------------------
17-با برش سرخرگ ششي وديواره بطن راست ، كدام دريچه را مشاهده خواهيد كرد؟
1-دو لختي     2-سه لختي      3-ميترال        
4-سيني   
-------------------------------------------------------------
18-در كدام يك از بافتها ، ديواره سلولي در اثر رنگ آميزي با بلو دو متيلن و كارمن زاجي به ترتيب آبي و قرمز مي شود؟
1-فيبر سلولزي-اسكلرانشيم                     

 2- اسكلرانشيم- فيبر سلولزي

3-پارانشيم-فيبر چوبي                                

 4-كلانشيم- فيبر چوبي
-------------------------------------------------------------
19-كدام اندام در كبوتر وجود ندارد ؟
1-معده        2-روده كوچك      
3-روده بزرگ          4-كلواك
-------------------------------------------------------------
20-شكل مقابل براي بررسي تأثير نور بر شدت فتوسنتز طراحي شده است.گزينه غلط كدام است؟
1-با نزديك شدن لامپ به ظرف ، تعداد حبابهاي متصاعد شده افزايش مي يابد.
در آب استفاده مي شود.
CO 2  2-از بيكربنات كلسيم براي بالا بردن تراكم

3-بايستي  لوله قيف زير آب باشد.
4-با افزايش فتو سنتز، مقدار آب در لوله آزمايش مي يابد .
-------------------------------------------------------------
21-سلولهاي ماهيچه اي با تعدادي هسته در كدام ناحيه مشاهده مي شود؟
1-پيلور      2-ديواره مثانه        3-حلق        4-ابتداي راست روده
-------------------------------------------------------------
     از سلولهاي پياز كدام گزينه صحيح است؟DNA22-در ارتباط با استخراج

1-الكل باعث تخريب ديواره سلولي مي شود        2-الكل باعث جدا كردن مي شودRNAاز DNA


 مي شود.          4- الكل سرد سبب رسوب پروتئين مي شود.  DNA3-الكل سرد سبب رسوب

-------------------------------------------------------------

23-كداميك از قسمتهای قلب داراي ديواره قطورتري مي باشد ؟
1-بطن چپ     2-دهليز چپ    3-دهليز راست      4-بطن راست

-------------------------------------------------------------
24-غضروف نايژه داراي كدام ويژگي مي باشد ؟
1-ضخيم وغير قابل انعطاف         2-ضخيم وانعطاف پذير
3-نازك وانعطاف پذير                  4- نازك وغير قابل انعطاف
-------------------------------------------------------------
25-كداميك از گزينه هاي زير درباره عدسي چشم صحيح است ؟
1-مقعرالطرفين-نيمه شفاف                           

 2-محدب الطرفين- نيمه شفاف
3- مقعرالطرفين- شفاف                                 

 4- محدب الطرفين- شفاف
-------------------------------------------------------------

سوالات تشريحي******

-------------------------------------------------------------
1-روش تهيه بافت ماهيچه مخطط ومشاهده آن در زير ميكروسكوپ را شرح دهيد.
-------------------------------------------------------------
2-ويژگيهاي سرخرگهاوسياهرگهاي قلب را با يكديگر مقايسه كنيد.
-------------------------------------------------------------
3-در برش طولي كليه ، قسمتهاي مختلفي را كه مشاهده مي كنيد نام ببريد.
-------------------------------------------------------------
4-آزمايشي طراحي كنيد كه نشان دهنده عمل تنفس در گياهان خشكي باشد.
-------------------------------------------------------------
5-روش تهيه بافت استخواني ومشاهده ي سيستم هاورس در زير ميكروسكوپ را توضيح دهيد.
-------------------------------------------------------------

 

                                                             

 

 

 

سوالات مسابقات آزمایشگاهی

***سؤالات مسابقات آزمايشگاهی زيست شناسي ناحيه 5مشهد***

-------------------------------------------------------------

1-كدام يك از اجزاي ميكروسكوپي در تشكيل تصوير نقش عمده اي ندارد؟

1-منبع نور        2-اثر كتيف         3-لوله ميكروسكوپ       4-اوكولر
-------------------------------------------------------------
2-براي شروع كار با ميكروسكوپ ، بهتر است از كدام عدسي شيئ استفاده نمائيم؟

1-4                2-10                  3-40                        4-100
-------------------------------------------------------------
3-مشاهده كروموپلاستها در كدام يك به راحتي انجام ميگردد؟

1-بشره تره      2-دانه گندم         3-سيب زميني            4-ريشه هويج
-------------------------------------------------------------

4-چنانچه درآزمايش گروه خوني ، آنتي كرهاي D(ضدRHAرسوب داده باشد، گره خوني فرد كدام است؟

1-A-               2-A+               3-+B                         4-B- 
-------------------------------------------------------------

5-براي مشاهده تو‍‍‍أم بافت پارانشيم وكلانشيم ، كدام را پيشنهاد مي كنيد؟

1-مشاهده برش عرضي ساقه نعناع                

 2- مشاهده برش عرضي ساقه گياهان مسن

3-مشاهده برش طولي گياهان دولپه               

4-ممكن است اين دوبافت باهم ديده نشوند.
-------------------------------------------------------------

6-وجود 5 قوس آئورتي كه مري را دور مي زنند از اختصاصات كدام جانور است ؟

1-قورباغه         2-كرم خاكي          3-كبوتر              4-ملخ
-------------------------------------------------------------

7-در تشريح مغز چنانچه در امتدادجسم كرمينه اي برش داده شده و2نيمكرهاز هم جدا شوند،  بلافاصله در زير آن كداميك مشاهده مي شود؟

1-بطن3                             2-برجستگي هاي چهار كانه     

 3-پل مغزي                         4-بطن4
-------------------------------------------------------------

8-كدام يك كف بطن هاي جانبي را تشكيل مي دهد؟

1-جسم پينه اي         2-پايكهاي مغزي      

3-رابط 3گوش                4-تالاموس
-------------------------------------------------------------

9-كدام يك از بخشهاي زير در سطح پشتي مغز قابل مشاهده است؟

1-كرمينه                          2-كياسماي بينايي     

3-پايك هاي مغزي           4-برجستگي حلقوي
-------------------------------------------------------------

10-كدام يك از ويژگيهاي گياهان دو لپه مي باشد ؟

1-رگبرگهاي موازي                           2- ريشه راست     

3-اجزاي گل 3يا مضربي از آن   4-برگ سوزني شكل
-------------------------------------------------------------

11-در برش ميكروسكوپي ريشه ، كدام يك مشاهده نمي گردد ؟

1-پوست بيشترين بخش ريشه را تشكيل مي دهد.
2-دسته جات آوندي چوب و آبكش بصورت يك در ميان مي باشند.
3-آوندهاي چوبي قطورتر به سمت خارج قرار دارن‍‍‍د.
4-آندوردرم ، داراي نوار كاسپاري است .

 

 


-------------------------------------------------------------

12-درآزمويش مربوط به جستجوي آميلاز در ميكروبهاي خاك،‌احتمال وجود
 آميلاز در كدام نقطه بيشتر است ؟
1-
A                     2-B               

3-C                     4-D

 

 

 


 

-------------------------------------------------------------

13-ديواره سلولهاي پارانشيمي در رنگ آميزي مضاعف به چه رنگي ديده مي شوند ؟
1-قرمز          2-سبز           3-بنفش           4-آبي

14-دي اكسيدكربن موجود در هواي بازدمي محلول برم تيمول را به چه رنگي درمي آورد ؟
1-سبز         
2-زرد             3-قرمز             4-آبي

----------------------------------------------------------  

15- در اپيدرم تره ، چند نوع سلول ديده مي شود ؟

1-1              2-2               3-3                 4-4

-------------------------------------------------------------
16-كدام يك از گزينه هاي زير،نشان دهنده فعاليت عضله مستقيم داخلي چشم است؟
1-چشم راست را در جهت عقربه هاي ساعت مي گرداند.
2-كره  چشم را به طرف خارج مي گرداند .
3-چشم راست را مخالف مورب بالايي مي گرداند .
4-كره چشم را به طرف بيني مي گرداند.
-------------------------------------------------------------
17-با برش سرخرگ ششي وديواره بطن راست ، كدام دريچه را مشاهده خواهيد كرد؟
1-دو لختي     2-سه لختي      3-ميترال        
4-سيني   
-------------------------------------------------------------
18-در كدام يك از بافتها ، ديواره سلولي در اثر رنگ آميزي با بلو دو متيلن و كارمن زاجي به ترتيب آبي و قرمز مي شود؟
1-فيبر سلولزي-اسكلرانشيم                     

 2- اسكلرانشيم- فيبر سلولزي

3-پارانشيم-فيبر چوبي                                

 4-كلانشيم- فيبر چوبي
-------------------------------------------------------------
19-كدام اندام در كبوتر وجود ندارد ؟
1-معده        2-روده كوچك      
3-روده بزرگ          4-كلواك
-------------------------------------------------------------
20-شكل مقابل براي بررسي تأثير نور بر شدت فتوسنتز طراحي شده است.گزينه غلط كدام است؟
1-با نزديك شدن لامپ به ظرف ، تعداد حبابهاي متصاعد شده افزايش مي يابد.
در آب استفاده مي شود.
CO 2  2-از بيكربنات كلسيم براي بالا بردن تراكم

3-بايستي  لوله قيف زير آب باشد.
4-با افزايش فتو سنتز، مقدار آب در لوله آزمايش مي يابد .
-------------------------------------------------------------
21-سلولهاي ماهيچه اي با تعدادي هسته در كدام ناحيه مشاهده مي شود؟
1-پيلور      2-ديواره مثانه        3-حلق        4-ابتداي راست روده
-------------------------------------------------------------
     از سلولهاي پياز كدام گزينه صحيح است؟DNA22-در ارتباط با استخراج

1-الكل باعث تخريب ديواره سلولي مي شود        2-الكل باعث جدا كردن مي شودRNAاز DNA


 مي شود.          4- الكل سرد سبب رسوب پروتئين مي شود.  DNA3-الكل سرد سبب رسوب

-------------------------------------------------------------

23-كداميك از قسمتهای قلب داراي ديواره قطورتري مي باشد ؟
1-بطن چپ     2-دهليز چپ    3-دهليز راست      4-بطن راست

-------------------------------------------------------------
24-غضروف نايژه داراي كدام ويژگي مي باشد ؟
1-ضخيم وغير قابل انعطاف         2-ضخيم وانعطاف پذير
3-نازك وانعطاف پذير                  4- نازك وغير قابل انعطاف
-------------------------------------------------------------
25-كداميك از گزينه هاي زير درباره عدسي چشم صحيح است ؟
1-مقعرالطرفين-نيمه شفاف                           

 2-محدب الطرفين- نيمه شفاف
3- مقعرالطرفين- شفاف                                 

 4- محدب الطرفين- شفاف
-------------------------------------------------------------

سوالات تشريحي******

-------------------------------------------------------------
1-روش تهيه بافت ماهيچه مخطط ومشاهده آن در زير ميكروسكوپ را شرح دهيد.
-------------------------------------------------------------
2-ويژگيهاي سرخرگهاوسياهرگهاي قلب را با يكديگر مقايسه كنيد.
-------------------------------------------------------------
3-در برش طولي كليه ، قسمتهاي مختلفي را كه مشاهده مي كنيد نام ببريد.
-------------------------------------------------------------
4-آزمايشي طراحي كنيد كه نشان دهنده عمل تنفس در گياهان خشكي باشد.
-------------------------------------------------------------
5-روش تهيه بافت استخواني ومشاهده ي سيستم هاورس در زير ميكروسكوپ را توضيح دهيد.
-------------------------------------------------------------

 

                                                             

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

+ نوشته شده در  سه شنبه بیست و یکم اسفند 1386ساعت 15:8  توسط زارع زاده  | 

دونمونه آزمون درس زيست شناسي و آزمايشگاه يک (پاياني) 


مدت آزمون: 75 دقيقه پايه: دوم رشته : علوم تجربي


1- جاهاي خالي را با کلمات مناسب پرکنيد:


مونوساکاريدي که در ساختمانRN وجود دارد،..............است


برخي باکتري ها براي اتصال به ديواره روده ميزبان خود از برآمدگي هاي مٌومانندي به نام............. استفاده مي کنند


در ساقه گياه، بخشي از مغز ساقه که در ميان دستجات آوندي قرار گرفته،............... ناميده مي شود


هورمون................ از غدد مجاور پيلورمعده ترشح شده و آنزيم مي گردد


به هوايي که بعد از يک دم عميق با يک بازدم عميق از شش ها بيرون مي دهيم .................. مي گوييم


آنزيم ................. در غشاي گلبول قرمز به جابه جايي کربن دي اکسيد خون کمک مي کند


به کل فرآيندهايي که براي حفظ حالت پايدار در محيط داخلي جانداران کمک مي کنند،................. مي گوييم


انقباض خفيف ماهيچه اي که در زمان بيداري، که موجب حفظ حالت سروتنه مي شود،................ناميده مي شود


2- صحيح يا غلط بودن هرجمله را مشخص نمائيد:


کاتالاز آنزيمي است که آب اکسيژنه را به آب و اکسيژن تجزيه مي کند


سلول ها براي انجام انتشار تسيهل شده از انرژي زيستي استفاده نمي کنند


درنورون ، دتدريت پيام عصبي را از جسم سلولي به سوي انتهاي سلول هدايت مي کند


ترشح املاي صفراوي از کيسه صفرا ،موجب کاهش حرکات دوري روده باريک مي شود


جريان هواي درون شش هاي پرندگان ،يک طرفه واز عقب به سوي جلوي بدن است


در الکتروکارديوگرام بيمار مي گرددQRS انفارکتوس قلب موجب کاهش ارتفاع موج


وزع ها در آب، وارده و وقتي در خشکي هستندآمونياک دفع مي کنند


در گياه حساس ميموزا، لمس برگ ها موجب حرکت فعال بساوش تبخي در برگ ها مي شود


3- براي هر يک از انواع پروتئين هاي زير، يک مثال مناسب بنويسيد:


الف- پروتئين نشانه اي: ب- پروتئين منقبض شونده:


4- هريک از موارد زير دقيقاً در کدام بخش سلول گلبول سفيد(لنفوليت) ساخته مي شوند؟


الف- پادتن: ب- ريبوزوم:


5- دو نوع سلول اسکرانشيمي در گياهان را نام ببريد


6- الف) آنزيمي که در دهان گوارش شيميايي را شروع مي کند چه نام دارد؟


ب) اين آنزيم بر چه ماده ي غذايي اثر مي کند؟


7- در موارد زير مشکل تنفسي بيش تر مربوط به چه اختلالي در دستگاه تنفسي است؟


الف- نفس تنگي در هنگام آسم: ب- مشکل دَم در نوزادان زودرس:


8- دو عامل عمده به وجود آورنده ي خيز (يا اِدِم)در بيماران کدام اند؟


9- دو راه دفع مواد زايد در گياهان را بنويسيد


10- هريک از بخش هاي زير در کدام نوع بافت استخواني ديده مي شوند؟


الف- سيستم هاورس: ب- مغز قرمز استخوان:


11- الف) نوار کاسپاري در کدام لايه از سلولهاي ريشه گياهان ديده مي شود؟


ب) نقش نوار کاسپاري در ريشه چيست؟


12- علل اصلي بروز" پٌلي سيتمي " در انسان چيست ؟( دو مورد)


13- الف) علّت بازجذب اوره در کليه ها چيست؟


ب) در کدام بخش از لوله هاي توليد کننده ي ادرار اوره بازجذب مي شود؟


14- توضيح دهيد حرکتهاي تبخشي در گياهان اساساً با حرکت های گرایشی (تروپیسم ها) چه تفاوتی دارند؟( ذکر یک تفاوت)


توضیح دهید چگونه تنفس گازکربن مونوکسیدباعث مرگ انسان می شود؟(مکانیسم مسمویت )


16- با ذکر مثال تفاوت انقباض ایزوتونیک را با انقباض ایزومتریک بنویسید 17- توضیح دهید کلیه ها چگونه موجب حفظخون در حّد تقریباً ثابتی می شوند؟


18- در مورد بافت گرهی قلب (بافت هادی) به سوال های زیر پاسخ دهید:


الف) این بافت نوعی بافت ماهیچه ای است یا عصبی؟


ب) سرعت انتشار تحریک در کدام بخش از بافت گرهی بیش تر است؟


ج) گره پیش آهنگ در چه قسمتی از قلب قرار گرفته است؟( محل دقیق ذکر شود!)


19- توضیح دهید از شروع سیستول بطن ها تا پایان آن (شروع، ادامه، خاتمه) ، کدام دریچه های قلب بسته و کدام باز می شوند؟


20- با ذکر سه دلیل فرضیه جریان فشاری یا مدل جریان توده ای مونش را رّد نمائید!


21- الف) در شکل زیر بالک را نشان دهید


ب) بالک چه نقشی در صعود پرنده دارد؟


22- جاهای خالی را در طرح مفهومی زیر( فرآیند لخته شدن خون) با کلمات مناسب پرکنید


23-طرح زیر یک نفرون را نشان می دهد در روی شکل به جای علامت سوال(؟) نام منتسب هر بخش را بنویسید


(دومورد)


24 در شکل زیر، صفحه هنسن خط Z- محل خطM و یک سارکومر را مشخص نمائید،


ساختار بخشی از یک سلول ماهیچه ای



1- موارد صحیح و غلط را مشخص نمائید:


الف) در واکنش هیدرولیز، آب آزاد می شود( )


ب) در واکنش آنزیمی پیش ماده به جایگاه فعال آنزیم متصل می شود( )


ج) پیچش ساقه گیاهی دور ساقه گیاه دیگر جزء حرکات تاکنیکی محسوب می شود( ) د) ماهیها و خزندگان اسکلت درونی دارند( ) 1


2- در جای خالی کلمات مناسب قرار دهید


الف) در بخش خارجی پوست ساقه های جوان بافت قرار دارد


ب) سلولهای کوتاه و انشعاب دار بیشتر در پوشش دانه ها و میوه ها دیده می شود نام دارد


ج) اندامکی که در سازماندهی میکروتوبول ها دخالت دارد نام دارد


د) عمل تغییرات ملکول ها و نشانه گذاری آنها در اندامک 2


3- کار هر کدام از موارد ستون الف را در ستون ب پیدا کرده جلوی هر مورد بنویسید


الف ب


1- شبکه مویرگی اول جمع آوری ادرار


2- شبکه مویرگی دوم باز جذب گلوکز و اسید آمینه


3- لوله هنله بازجذب آب


4- لگنچه عمل تراوش عمل ترشح


4- به چه علت حل شدن نشاسته در آب از مونودی ساکاریدها مشکل تر است؟( یک دلیل)


5- اگر برگه هلو ( پر هلوی خشک) را در آب قرار دهیمم چه تغییری در آن ایجاد می شود؟ ( طبق کدام قانون)


6- الف: طبق نظریه هم چسبی – کشش عوامل اصل حرکت مواددر آوندهای چوپی کدام است؟( دو مورد)


ب: آرایش شعاعی رشته های سلولزی دیواره سلولهای نگهبان روزنه چه نقشی در بازشدن روزنه ها دارند؟


7- در تشرح قلب هرکدام از موارد زیر چگونه تشخیص داده می شود؟


الف: بطن راست ب: سرخرگ آئورت


8- موارد زیر را تعریف کنید


الف: گره لنفی: ب: گردش خون باز:


9- الف: دو کار اصلی اسیدمعده را بنویسید


ب: آنزیم سلولاز در لوله گوارش کاو و اسب توسط چه موجودی تولید می شود؟ و چه کاری انجام می دهد؟


10- الف: یک تفاوت بین سیستم هاورس و بافت استخوانی اسفنجی را بنویسید


ب: کلسیم در کدام بخش سلولهای ماهیچه ای مخطط ذخیره می شود و چه نقشی در این سلولها ایفاء می کند؟


11- در منحنی الکتروکاردیوم همزمان با موجQRSوT کدام دریچه ها بسته می شوند؟چرا؟


12- اگر شخصی به مدت زیاد در ارتفاعات زندگی کند (یعنی محلی که میزان اکسیژن کم است)، کدام هورمون در بدن این فرد افزایش می یابد؟چرا؟


13- الف: موارد 1 و 2 در شکل را نامگذاری کنید


ب:جهت حرکت خون را در محلهای 3 و 4 به وسیله فلش مشخص کنید


14-در شکل سارکومر ، نوار تیره و نوار روشن خط-ZوM را دقیقاً مشخص نمایید .


15- یک تفاوت انقباض ایزوتونیک و ایزومتریک را بنویسید


16- برای محل قرار گرفتن هریک از بافتهای زیر یک مثال بنویسید


الف: ماهیچه صاف ب: بافت پوششی استوانه ای


17- هرکدام از موارد زیر دردستگاه گوارش چه کاری انجام می دهند؟( هر کدام یک مورد)


الف: موسین: ب: فاکتور داخلی معده


18- دو خصوصیت مهم میکروسکوپ الکترونی گذاره را بنویسید


19- طرح را کامل کنید:( موارد الف وب)


20- دو نمونه حرکت های القایی گیاهان را بنویسید


21- پرده جنب و سورفکتانت چه نقشی در دستگاه تنفسی دارند؟( هر کدام یک مورد)


22- اگر در آزمایش مشخص شود که ظرفیت حیاتی شخصی کمتر از میزان طبیعی آن است، چه اشکالاتی در دستگاه تنفس او ممکن است وجو داشته باشد؟( دو مورد)


23- الف: دو عامل بازجذب آب میان بافتی به رگهای خونی، در سیستم گردش خون را بنویسید


ب: علل بازگشت خون از سیاهرگها به قلب را نام ببرید ( دو مورد)


24- فردی دچار زخم معده می باشد پزشک به او توصیه کرده که آمپول تزریق نمایدبه نظر شما علت آن چیست؟( در این بیماری بخش زیادی از بافت پوششی معده تخریب می شود).

+ نوشته شده در  دوشنبه بیستم اسفند 1386ساعت 18:5  توسط زارع زاده  | 

جانور شناسي در قران

حیوانات - حشرات و پرندگان

پائين آوردن ارتفاع چهار يا هشت نوع از دامها

« و (خدا) هشت جفت (4 نوع) از دامها را برای شما پائین آورد».

«اَنعَام»: در اصل حيواناتی هستند که برای فرد نَعمَة هستند، ( و نَعمَة يعنی چيزی که رفاه و برخورداری و فراخی زندگی را می آورد)، ولی به دامها (حیواناتی که انسان در کار و زندگی و اقتصاد خود از آنها استفاده ميکند) و بيشتر به شتر و گاو و ميش و بز اطلاق می شود.  فعلِِ « اَنزَلَ» فعلِ ماضی از مصدر مزید «انزال» است، و اِنزال به معنی: پائین آوردن است. و منظور از پائین آوردن حیوانات مزبور برای انسان اینست که آنها در گذشته بلند بوده اند و برای کار و بهره وری انسان از آنها مناسب نبوده اند، و خدا ارتفاع آنها را بخاطر امکان استفاده انسان از آنها پائین آورده است. «ازواج»: در آيه می تواند بمعنی جفت باشد که در آنصورت هشت جفت بمعنی چهار نر و چهار ماده  از چهار نوع از دامها می شود، و می تواند بمعنی "صنف" باشد که در آنصورت بمعنی هشت نوع از دامها خواهد بود.

فسيلهای پيدا شده حيوانات نشان می دهند که نسل برخی از حيوانات در گذشته از نظر بلندی بلندتر و از نظر حجم بزرگتر از نسل امروزی آنها بوده، و نسل برخی ديگر در گذشته کوچکتر از نسل امروزی آنها بوده است، و همينطور نشان می دهند که حيوانات چگونه در ضمن ده ها ميليون سال تغييراتی کرده اند.

یکی از آن حیوانات که نسل گذشته آن بلندتر و بزرگتر بوده شتر است. فسيل پای شتر که در تصوير می بينيم و در سوريه پيدا شده نشان میدهد که شتری که در گذشته زندگی می کرده دو برابر شتر امروزی بوده، و فسيلهای ديگر که مربوطه به دوران ديگری است نشان می دهد که شتر در گذشته 4 متر ارتفاع داشته است. بهر حال چنانکه آيه گفته خداوند ارتفاع آنرا برای انسان پائین تر آورده تا برای انسان قابل استفاده بشود. ارتفاع شتر امروزی به دو و نيم متر می رسد.

دين ستيزی و له له زدن سگ

آیه 175 سوره اعراف از کسی صحبت میکند که آیات خدا را دور انداخته و بجای آن پيوسته هوس خود را دنبال کرده، و در ادامه آن آیه 176 چنين می گويد:

« و اگر می خواستیم او را با آیات خود بلند مي کردیم ولی او زمین گیر شد (یعنی اگر "ما" می خواستیم برای او تصمیم بگیریم و انتخاب کنیم او را بلند می کردیم، ولی انتخاب به او دادیم و او به زندگی و مال دنیا دل بست) و پيوسته هوس خود را دنبال نمود، بنابر اين او مانند سگ میماند، اگر بار روی آن بگذاری له له می زند اگر هم آنرا رها کنی له له می زند. اينست نمونه کسانیکه آیات خدا را دروغ می پندارند. داستانهای واقعی را بگو با امید به اینکه اینها بينديشند».

له له زدن سگ تنفس سريع است با دهانی باز و با زبانی معمولاً افتاده به بيرون از دهان. سگ در حالت عادی ميان 30 تا 40 نفس می زند و در حالت له له زدن ميان 300 تا 400 نفس. سگ اغلب هنگام بالا رفتن دمای گرمای بدنش له له می زند تا خود را خنک کند، چون غده های عرقی کافی برای خنک نمودن خود ندارد، (کمی در پاها دارد که برای خنک نمودن بدن آن کافی نيست) بنابر اين با له له زدن خود را خنک می کند. در نفس زدن هوای خنک وارد بدن ميشود و هوای گرم از بدن خارج می شود و به اين وسيله خود را تهويه و خنک ميکند.

سگ علاوه بر دليل فوق که "بالا رفتن دمای گرمای بدن وی" بود، بدلايل زياد ديگری همچون تشنگی، شادی، خوشنودی، ناخوشنودی، برخورد ناگهانی با چيزی، کار و خستگی، درد های روانی و جسمی، اندوه و غيره نيز له له میزند.

آيه گفت نمونه کسانيکه آيات خداوند را دروغ می پندارند مانند سگ است که چه بار روی آن بگذاری و چه آنرا بحال خود واگذاری در هر حال له له خود را می زند. بنابر شناختی که از سگ داريم معنی اين تشبيه اينست که فرد دين ستيز در هر حال دين ستيزی خود را دارد چه دين بنوعی با او کاری داشته باشد و چه نداشته باشد. ما امروزه درستی اين گفته آيه را در غرب می بينيم. امروزه در غرب دين اساساً با کسی کاری ندارد، ولی دين ستيزان دين ستيزی خود را دارند. يعنی اين از سرشت آنهاست همانگونه که له له زدن سگ نيز از سرشت خود آنست و می تواند هيچ ربطی به کار و رفتار انسان با آن نداشته باشد. (و سرشت انسان البته از نظر قرآن بدست خود انسان است).

حيوانات از بخش جلو مغز خود هدايت می شوند

«من به خدا آفريننده خودم و آفريننده شماها توکل کردم، هيچ حيوانی وجود ندارد که او از ناحيه جلو مغزِ آن آنرا هدايت نکند».

تاکنون برخی از حيوانات شناخته شده اند که در مغز خود عـنصر قطب نمائی دارند، که به کمک جريانهای مغناطيسی شمالی ــ جنوبی زمين که در تصوير وضعيت آنرا می بينيم هدايت میشوند. حيوانات با عنصر قـطب نمائی خود محل زندگی  و مسير پرواز و حرکت خود را ميشناسند.

اگر آهن ربائی را در نزديکی مغـز يک پرنده ببنديم، سيستم جهت يابی مغز وی را مختل می کند و پرنده نمی تواند مسير و محل زندگی خود را پیدا کند. (قرآن هر جانوری را (دابة) يعنی حيوان می نامد. و منظور ما از حيوانات در اينجا مطلق جانداران است که شامل پرندگان و حشرات و ماهی ها و غيره هـمه می شود).

کلاغ و خاکسپاری مرده

«پس از آن خداوند کلاغی را برانگيخت زمين را می کند تا به او (به قابيل) نشان دهد "چگونه پيکر برادر خود را به خاک بسپارد"، (قابيل) گفت: ای وای بر من! آيا من ناتوان تر از آن بودم که مانند اين کلاغ بوده پيکر برادرم را به خاک بسپارم. به اين تزتيب پس از آن از پشيمانان گشت».

نکات آيه:

1ــ کلاغ مرده را خاک سپاری می کند:

چرا خداوند کلاغ را برای آموختن خاک سپاری مرده به انسان می فرستد؟ پژوهشهای انجام شده روی پرندگان نشان می دهد که کلاغ فهميده ترين پرندگان است و ويژگيهائی دارد که آنرا از ديگر پرندگان جدا می کند، از مهمترين آنها يکی اينکه حجم مغز آن نسبت به بدنش نسبت به ساير پرندگان بزرگتر است، و ديگر اينکه مرده خود را بخاک می سپارد. وقتی کسی از کلاغها می ميرد، کلاغ ديگر با منقار و چنگالهای خود گور می کند و پس از آن بالهای کلاغ مرده را گرد می کند و به کنار بدن آن می آورد (همانگونه که ما با مرده خود می کنيم)، و پس از آن مرده را با احترام بلند می کند و در گور خود می گذارد و بعد روی آن خاک می ريزد. حتی کلاغی که گناهی می کند و در دادگاه کلاغان گناهکار حساب شده و به اعدام محکوم می شود و او را با منقارهای خود می کشند نيز توسط يکی از کلاغها برای خاکسپاری برده می شود و بهمان ترتيب بخاک سپرده می شود. (کلاغ ويژگيهای ديگری از جمله ابزار سازی و بکارگيری ابزار برای رسيدن و دست يافتن به خواسته خود چنانکه در تصوير می بينيم نيز دارد ولی از آنجا که موضوع آيه نيست به آنها نمی پردازيم).

 2ــ مرده می بايست به خاک سپرده شود:

فرستادن کلاغ برای آموزش دادن خاکسپاری مرده به انسان، به اين معنی است که مرده می بايست به خاک سپرده شود. و مرده ضمن اينکه خوراکی برای درندگان می شود و می گندد و خاک سپردن آن احترامی به فرد مرده است، هنگاميکه تحليل می رود و در جو پراکنده می شود بيماريهائی را ايجاد می کند. بنابر اين چنانکه آيه مطرح نموده، دين از دير زمان به انسان ياد داده بوده که مرده را می بايست به خاک سپرد.

"صدای خران" آزار دهنده ترين صدای ناخوشايند جانوران

« و در راه رفتن خود ميان رو باش و صدای خود را پائين بياور که آزار دهنده ترين صدای ناخوشايند براستی صدای خران است». (آيه نقل قول از لقمان در پند و اندرز دادن به فرزند خود است).

نکات آيه:
1ــ پائين آوردن صدا:

صدا و سر وصدای بلند زمانی که پيوسته باشد زيانهای زيادی به بدن و روان انسان وارد می کند که مهمترين آنها عبارتند از: زياد شدن ترشح ادرنالين که بنوبه خود از جمله منجر به بهم ريختن عصبی فرد می شود ـــ ايجاد شدن تنشهائی در کارکرد بينی و گوش و حنجره ـــ مبتلا شدن به خيلی از بيماريهای قلبی و خونی از جمله بالا رفتن فشار خون و تصلب شرايين ــــ و تنشهای همراه با احساس سردرد مزمن و احساس فشار و سختی.

2ــ "صدای خران" آزار دهنده ترين صدای ناخوشايند جانوران است:

واحد اندازه گيری شدت صدا دسيبل است. شدت صدای پچ پچ و درگوشی ميان 10 تا 20 دسيبل است، صدای ماشين کوچک 70 تا 80 دسيبل، صدای ماشين باری 80 تا 90 دسيبل، صدای هواپيما هنگام کنده شدن از زمين 110 تا 130 دسيبل. پائين ترين صدائی که انسان می تواند بشنود 20 دسيبل است. هنگاميکه شدت صدا به 45 دسيبل می رسد انسان نمی تواند آسوده بخوابد، نزديک 85 دسيبل دردهای گوش آغاز می شود. در سر و صداهای نزديک به 90 دسيبل آدم نمی بايست 8 ساعت بيشتر در آن فضا بماند، در 100 دسيبل نمی بايست بيش از دو ساعت بماند، در 110 دسيبل نمی بايست بيش از نيم ساعت بماند، و به 160 دسيبل که برسد آدم کر می شود.

و شدت صدای ناخوشايند خر که موضوع آيه می باشد بالای 100 دسيبل است. و امروزه انسان در ميان جانوران صدای ناخوشايندِ آزار دهنده شديدتری از صدای خر نمی شناسد و آنچه در آيه آمده مبنی بر اينکه "آزار دهنده ترين صدای ناخوشايند صدای خران است" درست است.

بلدرچين

« و ابر را بر شما سايبان نموديم و بر شما انگبين و بلدرچين فرود آورديم. (گفتيم) از خوردنيها و نوشيدنيهای پاکيزه ای که روزی  شما نموديم بخوريد. به ما نيز ستمی نمی نمودند بلکه به خودشان ستم می نمودند». («رزق» بمعنی: روزی، فقط مربوط به خوراکی و نوشيدنی است. هر چيزی که مستقيم و غير مستقيم به خوردن و نوشيدن مربوط می شود رزق ناميده ميشود).

در چهل سالی که بنی اسرائيل در سرزمين کنعان سرگردان بوده اند خداوند انگبين و بلدرچين را برای خوراک آنها برای آنها فرود آورده بوده است. چرا از ميان ساير پرندگان اين پرنده  بطرف آنها پرواز داده شده بوده است؟

اين پرنده از خانواده مرغان است ولی پرواز می کند. کمی از کبوتر کوچکتر است. بيشتر در علف زارها و کشت زارها ديده می شود. خيلی زود پرورش يافته بزرگ می شود. در هفته اول تولد خود 3 برابر بزرگ میشود، پس از 50 روز برای سر بريده شدن مناسب است و فاصله دو نسل آن 50 روز است. بطور ميانگين پس از 42 روز از عمر خود تخم می گذارد، و بيشترين تخم گذاری آن در عمر 70 روزگی آن است. در سال ميان 300 تا 350 تا تخم می گذارد. روزهای جوجه شدن تخم آن 17 تا 18 روز است. در برابر بيماريها مقاوم بوده و کم مصرف است.

 ضمن ويژگيهای نگهداری و پرورشی و اقتصادی بودن آن نسبت به پرندگان ديگر، از ارزش تغذيه ای بالاتری نسبت به پرندگان ديگر نيز برخوردار است. گوشت سينه آن 20.3% پروتئين، 2.9% روغن دارد، علاوه بر آن مواد معدنی از جمله آهن، کلسيوم، فسفر، همينطور ويتامينهائی از جمله ويتامين آ و ب دارد. کولسترول روغن آن پائين است (بالا بودن ميزان کولوسترول برای قلب خوب نيست). بافتهای گوشت آن نرم است (ساده جويده می شود). برای درمان نمودن درد مفاصل خوب است، سنگ را تحليل می برد. تخم آن از بهترين تخمهای پرندگان است و نسبت زرده تخم آن نسبت به تخم ديگر پرندگان بيشتراز سفيدی آنست (سفيدی آن 60.89%، زردی آن 31.85%، و قشر آن7.36% وزن آنست). و از مواد معدنی و ويتامينها و مواد غذائی غنی تری نيز برخوردار است. و بخاطر حجم کوچک آن و پايداری آن در برابر بيماريها و تحمل شرايط محيط زيست، نسبت به مرغهای ديگر اقتصادی تر محسوب می شود.و به اين خاطر نيز اين پرنده از ميان ساير پرندگان بر بنی اسرائيل نازل شده بوده است. انسان اهميت اقتصادی و غذائی آن را در اوائل قرن 18 شناخته و به پرورش آن پرداخته است.

خلقت شـتـر

 

«آيا نمی توانند ببينند شتر روی چه حسابی آفريده شده است»؟!

نـکـتـه آيـه: شتر روی حسابی آفريده شده!

شتر روی چه حسابی آفـريده شده است؟

1ـــ  داخـل دهـان آن از پوست سفـت و سخـت پـوشـيـده شـده کـه باعـث می شود بتواند گياهان دشت و صحرا که خشک و خاردار هستند را بخورد و زخمی نشود.

2ـــ  مژه های آن خيلی پرپشت و کيپ همديگر هستند که باعث می شود شن و ماسه و سـنگـريـزه هـای اطـراف به درون چشم وی نـفـوذ نکنند.

3ـــ گـوشـهـای آن کـوچکـ و پـوشـيـده از مـوهـای پـرپـشـت و بهم چسبيده است، که باعث می شود شن و ماسه داخل گوش آن نروند.

4ـــ  پـوسـته مـخاطی سوراخ بينی آن سطح خيلی پهنی دارند که راه نفوذ برای شن و ماسه به داخل بينی باقی نمی گذارند، ولی نم و رطوبت لازمه هـوای تـنـفـس را از هـوا می مکند و جذب می کنند.

5ـــ  کوهان آن محل ذخيره انرژی است. ضمن اينکه چربی آن قشری برای مقابله با گرما نيز هست.

6ـــ سطح کمر آن باريک است. که باعث می شود تابش گرم و سوزان نيم روزی خورشيد، فقط به قسمت کمی از بدن وی بطور مـؤثر بـتابـد. و در شرايط تابش قبل از نيم روز يا بعد از آن که خورشيد مايل می تابد، اگـر مـجـبـور باشد در آفـتـاب باشـد، رو به خـورشيد و يا پـشـت به خـورشيد زمين گير می شود. که اين نيز بنوبه خود باعث می شود تابش مؤثر خـورشيد فقط به سطح کم بالائی وی بتابد. پوسـت پـشمی وی نيز بخـش عـمده تابش گرمای سوزان را خـنـثی می کند. به اين ترتيب شتر می تواند گرمائی که خيلی از حيوانات ديگر را می کشد تحمل کند.

7ـــ کليه های وی قسمت زيادی از آبهای مصرف شده را دوباره پس می گيرند، (به اين خاطر ادرار آن غليظ است).

8ــــ پوست پـشـمی آن باريک و نرم است. هم گرما را خنثی می کند و هم بدن را خنک می کند.

9ــــ روده آن سلولهای جذب آب دارد. اين سـلـولـهـا قـسـمـت زيـادی از آب مـصـرف شـده مـوجود در غذای روده را جذب می کنند و برای بدن نگه می دارند. (به اين خاطر سرگين آن خيلی خشک است).

10ـــ  وقـتی ادرار می کند، دم خود را می جنباند تا ادرار به پـاهـا پاشيده شود. به اين شکل با خيس و مرطوب کردن خود به خنک شدن خود کمک می کند.

11ــــ  شکم وی خيلی بزرگ است. می تواند تا 200 ليتر آب بنوشد. علاوه بر آن مجراها و منابع ذخيره آب نيز دارد. که هنگام آب خوردن آنها را نيز پر می کند.

12ـــ مجرای خون وی در اعماق بدن قـرار نگرفـته بـلکه زير پوست گردن و پاها و پهـلـوهـا قرار گرفته است. اين باعث می شود که گرمای بدن را بيشتر به سطح بدن منتقل کند. و سـرخ رگـهـا حتی در شـرايـطـی که تقـريـباً بی آب باشند و در وضعيت تقريبی معادل يک دويست هزارم حجم واقعی خود، باز هم می توانند اکسيژن را به نقـاط مختـلف بدن منتقل کنند.

13ـــ  تکـيه گاهـهای وی در حالت نشستن (يعنی زانوها، آرنجها، و سينه) از قـشـر کلفـتِ پوستِ مرده تشکـيل شده است. اين قـشـر گرما را خنثی می کند و باعث می شود بدن آن زخم نشود.

14ـــ  کف پهن پای آن با يک قشر شاخه ای مجهز شده که باعث می شـود پای آن در شن و مـاسـه فـرو نرود. و پا را در مـقـابل ماسـه هـای تيز و گرم نيز محافـظـت می کند.

15ـــ درجه حرارت بدن وی می تواند خـيـلـی تغـيـيـر کـند ضمن اينکه از پستانداران است. حرارت بدن وی بين 34 تا 42 درجه در تغيير است. وقتی دما بالا برود دمای بدن وی نيز بالا می رود، اين امر باعـث می شـود کـه تـا دمـای مـشـخصی نيازی به عرق کردن برای خنک کردن خود نداشته باشد. و در مصرف آب خود صرفه جوئی کند.

شتر در واقع به حساب دشت و صحرا پرداخته شده است. يعنی برای گرما، کـمـبـود آب، شـن و مـاسـه.

کـسـانی می گـويـند دليلی برای وجود خدا نمی بينند. قرآن آنها را به مطالعه پديده های طبيعی مراجعه می دهـد. انـتـخـاب شتر از ميان ساير حيوانات برای مطالعه، به اين معنی است که وی چيزهای خاصی دارد. بر اساس شـناختی کـه ما امروزه از بافت بـيـولـوژيکی شـتـر داريـم نـيز در واقع همينطور هم هست، و می بينيم که در ساختار آفرينش شتر مغز و انـديـشـه و حساب و کتاب خوابيده است. در حالـيکـه در گذشته مردم فکر می کردند که تحمل شتر زياد است نه اينکه چيز خاصی در آن می ديدند.

گوشت خوک

« خوردن گوشت حيوان مرده ــ خون ــ گوشت خوک ــ گوشتِ حيوانی که بنامی غير از نامِ خدا سر بريده شده ــ گوشتِ حيوان خفه کرده شده ــ گوشتِ حيوان تحتِ ضربات کشته شده ــ گوشت حيوانيکه افتاده و در وضعيت بين مرگ و زندگی است ــ گوشت حيوانيکه بر اثر شاخ زده شدن مرده ـــ ... برای شما حرام شده است».

و در سوره انعام آيه 145 ضمن يادآوری تحريم گوشت خوک، خوک را حـيـوانـی انگـلی توصيف نموده:« ... لَحْمَ خِـنْـزِيـرٍ فَـإِنّـَهُ رِجْـسٌ = ... مگر اينکه گوشت خوک باشد، که موجودی انگـلی است».

در آیه 145 سوره انعام روشن کرده که منـظـور از حـرام بـودن خوردن خون «خـون مـسـفـوح» است، (خون مسفوح یعنی: «خـون ريخـتـه شده» که با هوا تماس پيدا کرده). دلـيـل تحريم آن نيز اين است که وقتی خون با هوا تماس پيدا می کند سمی می شود و می تواند بيماری زا باشد.

نکات آيات: خوک حيوانی انگلی و گوشت آن حرام است:

همانطور که قرآن مطرح می کند خوک در واقع يک حـيـوان انگـلی است. هم زندگی و هم روند توليد مثل آن هر دو انگلی است:

چرا گوشت خوک تحريم شده؟ چيزيکه فعلاً انسان امروز در مورد گوشت خوک میداند موارد زير است:

ـــــــ گـوشت خوک خيلی از انگـلها را منتقـل می کند. از جمله نوعی کرم (موسوم به کرمِ تِـنـيـا) که برخی از ناراحتی های دردناک را منجر می شود که برخی از آنها کشنده نيز هستند. عـناصـر آن در عـضلات و در چشم و مغز منتشر می شود. ميان 5 تا 25 درصد کـسـانـيـکـه گوشت خـوک مصرف می کنند ناراحتی نـاشی از کـرم مزبور را دارند. (اين کرم الـبـتـه در گوشت گاو نيز وجود دارد ولی کرم گوشت گاو خود بخود در انسان تکثير نمی شود اما کرم گوشت خوک بـدون عـامل تکـثير کننده تکثير می شود. هـمـيـنطور کرم خوک مقاومت بيشتری نسبت به کرم گاو دارد و براحتی کشته نمی شود و خطرناک تر است).

ـــــــ گوشت خوک طبقـه طبـقه است و ميان آنها پيه های متداخل در همديگر وجود دارد که بالاترين نسبت روغـن حـيوانی را دارند، و روغـن آن نيز از خطرناکترين نوع روغـن است. ( درصـد پـيه در گوشت خوک 28 درصد است در حـالـيکـه مثلاً در گوشت گاو 4 و نيم درصد).

ـــــــ گوشت خوک مـقـادير زيادی اسيد دارد. (ساير حيوانات 90 درصد اين اسيد را پس ميدهند ولی خوک فـقـط 2 درصـد آنرا پس می دهد). اين اسيد از جمله باعث الـتـهـاب مخ می شود.

يک متخصص آلـمانی نـتـيـجه مـطالعات خود و ديگران را در رابطه با گوشت خوک چنين بيان می کند: گوشت خـوک در مناطق گرم خطرناک تر از مناطق سرد است. در سودان و مناطق همجوار آن در يک شـرايط آب و هـوائی يکـسـانی تفاوت ميان سلامتی کسانی که گوشـت خوک می خورند و و کسانيکه نمی خورند خـيـلی زيـاد است. هـمـيـنـطـور در هند در يک آب و هوای مشترک، کسانی که گوشت خوک نمی خورند از کسانی که می خورند از سلامتی بالاتری برخوردار هـستند، بيشتر عمر می کنند و توان کاری بيشتری دارند. مثلا فرد پيری که گوشت خوک نخورده حمالی می کـند و از ارتـفـاعـات بــالا می رود، در حاليکه آنکه خورده نمی توانـد اين کارها را بکند و زودتر ضعف و بازنـشـسـتـگـی بـسراغ وی می آيد.  کسانيکه با تعالـيـم اسـلامی زنـدگی می کـنـنـد از سلامتی خـوب و بـالائی بـرخوردارند و بـيماريهائی که ديگران از مسائل تحريم شده دارند آنها ندارند. همينطور وی می گويـد در جريـان جـنـگ جهانی دوم از ارتش گـزارشی برای آنها می آيد که می گويد: سربازان آلمانی دچار ناراحتی ها و آبله هائی در پاها می شده اند که آنها را از جنگ و تـحـرک بـاز می داشـتـه و علاج سرپائی نيز برای آنها کافی نبوده بلکه به پشت جبهه انـتـقـال داده می شـده انـد. در حالـيکه مـردمـی کــه در هـمان مناطق و همان آب و هـوا زنـدگـی می کرده اند آن ناراحتی ها را نداشته اند. پس از بررسی ها می بينند که ارتش تـقـريـبـاً هـمـه روزه از گوشت خوک استفاده می کند. گوشت خوک را قطع می کنند و آن ناراحتيها تمام می شود.

هـمـيـنطور می گويد پس از اتمام جنگ که وضعيت اقتصادی خراب می شود و خوک بوفور طبق روال عادی نبوده اندازه مراجـعـات به پزشک نسبت به دوران پيش از جنگ کاهش پيدا می کند. ولی با رونق گرفتن اقتصاد و خورده شدن گوشت خوک توسط طـبـقـه ای کـه وضع خوبی داشته، بيماريها دوباره در آنها شروع می شود، در حاليکه طـبـقـه فـقـير که هنوز توان استفاده از گوشت خوک را نداشـتـه از سـلامتی بهتری برخوردار بوده است. و پـس از اينکه فـقـيـران نيز تـوان خريدن و خوردن آنرا  پـيـدا می کـنند دوباره وضع بيماريها طـبق روال پيشينِ خود زياد و هـمـه گـيـر مـی شـود. هـمـيـنـطـور وی می گويد که به آزمايشهای عملی در رابطه با گوشت خوک رو می آورد. 30 تا مـوش را با خـوراک خوک بزرگ می کند و 30 تای ديگر را با غذای عادی. آنهائـيـکه غذای خوک داده می شوند: سريعا بزرگ می شـونـد ـــ تـمـايلات تجاوزگرانه در آنـهـا ايـجـاد می شود، و دوست دارند که هـمـديگـر را بخورند و بيماريهائی از قـبـيـل سـرطـان و بيماريهای پوستی در آنها ظاهر می شود، ولی آنهائی که غـذای عـادی بزرگ می شـونـد هـيـچـيـک از ايـن مـوارد در آنهـا ظاهر نمی شود. او محتاطانه می گويد در گوشت خوک سمی است که فهميده نمی شود و روغن آن خطرناکـترين نوع روغن است. و مـوجـب تصلب شـرايين، بيماری قند، اختلال جريان خون، و نسبت بالائی از کلسترل را باعث می شود، و بافتهای آن فـسـفـر دارد که منجر به زيانهائی می شود.

شيرسازی دامها

« و در دامها نيز برای شما درس وجود دارد. از آنچه در شکم دارند از ميان غذای معده  و خون شير ناب را به شما می نوشانيم که برای نوشندگان گوارا است».

ماده اصلی شير چنانکه آيه گفته از ميان غذای درون معده و درون خون گرفته می شود. غده های توليد کننده شير مواد خود برای توليد شير را از خون و از مايعات بدن که مواد غذائی معده را آورده اند می گيرد.رود.

در زمان پيامبر می توان گفت که انسان بهرحال می دانسته که شير از غذای جويده  و خورده شده گرفته و توليد می شود، ولی اينکه آن مواد وارد خون نيز می شوند و بعد از ميان خون گرفته می شوند طبعاً کسی چيزی نمی دانسته است.

گوشت ماهی

« و اوست که دریا را برای شما مسخـّر کرد که گوشت سبک از آن بخورید». (طـَریّ بمعنی: تر و تازه ـــ نرم و آسان و سبک (از نظر کاربرد و کارکرد) ـــ و نم دار است).

آیه می گوید گوشت دریا (که عمدتاً ماهیها باشند)، از نظر کارکرد آسان و سبک هستند. ماهیها و خیلی از موجودات دریائی دارای روغنی مانند روغن زیتون هستند که برای معده سبک است، برای هضم آسان است، میزان غلظت خون را بالا نمیبرد بلکه بر عکس از کلسترول مضر کم میکند و کلسترول مفید را بالا میبرد که بنوبه خود از پیامدهای بد آن که از جمله راه بردن به ناراحتیهای قلبی است جلوگیری میکند.

مـورچـه

 

« تا اينکه وقتی (سليمان و سپاهيان وی) به دره مورچه ها رسيدند مورچه ای گفت: مورچه ها! داخل خانه های خود شويد تا سليمان و سپاه وی شما را خرد نکنند؛ آنها خرد شدن شما را احساس نمی کنند».

نکات آيه:

مورچه ها با هم صحبت می کنند: مورچه ها از جمله با مواد بودار شيميائی با هم صحبت می کنند.

2ـ مورچه ها زير فشار خرد ميشوند: علت اينکه آيه واژه خرد شدن بکار برده اينست که بدن مورچه به اندازه زيادی از مواد شيشه ای تشکيل ميشود. به اين خاطر هنگامی که زير فشار قرار ميگيرد خرد ميشود.

زنـبـور عـسـل

 

«و خدا به زنبورعسل وحی نمود کـه: از کوهها، درختان و از کندوهائی که مردم درست می کنند برای خود آشيانه بگير. بعد ازهر ثمری بخور و بعد (در بازگشت) مسيرهای مشخص شده پروردگار خود را دنبال کن (يا مسيرهای ساده شده پروردگار خود را دنبال کن). از شکمهای آن نوشيدنی با رنگهای گوناگون در می آيد و در آن مداوائی برای مردم وجود دارد. در اين رابطه برای افراد انديشمند نشانه ای وجود دارد».

(«ذللاً» جمع ذلـول است و از جمله به معنی: ساده، آسان، رام، بی درد سر و بی زحـمت است. اگـر در آيه «حال» بـرای «نحـل (زنبور)» باشد، معـنی جمله آن اين می شود که: زنبور از مسيری پيروی کند که برای وی مـشـخـص شـده. و اگر «ذللاً» حـال بـرای سُـبُـل باشـد، در آنصورت جمله به اين معنی می شود که: مـسـيـر بـازگـشـت زنـبـور آسان و بی زحمت شـده است. و هـر دو حالـت آن درست است).

نکات آيه: 1ـــ مسير بازگشت زنبور عسل رُند و بی درد سر است. 2ــ از شکم زنبور عسل نوشيدنی در می آيد. 3ــ عسل شفا بخش است.

1ـــ مسـيـر بازگشت زنبور عسل رند و بی درد سر است:

زنبور عسل با اشعه فوق بنفش می بيند. وقتی مسيری را می رود مـغـز آن زاويه هـای نـور خورشيد را ضبط می کند. در بازگشت بر اساس همان اطلاعات برمی گردد. وقتی هوا ابری باشد نيز خورشيد را با تحليل نور می تواند از پشت ابرهـا ببيند. جهات مغناطيسی شمال و جنوب نيز بکار می گيرد. و کندوی خود را هم از بوی آن می شناسد.

به اين ترتيب زنبور عسل در رديابی و مسـيـرشناسی هـيـچ مشکلی ندارد. و چنانکه آيه گفته: زنبور پس از اينکه ثمر پيدا می کند و می خورد، در بازگشت از مـسـيـری کـه برای وی تعيين شده پيروی می کند، و يا مسير بازگشت وی آسـان و بی دردسر است، (بـسـته به ايـنکـه جـمـلـه آن را چطوری تجزيه و تحلـيـل کـنيم).

2ــ از شکم زنبور عسل نوشيدنی در می آيد:

عسلی که زنبور در شکم خود درست می کند و در خـانه های کندو می ريزد 80 درصد آن آب است. يعـنی هـمـانـطـور که قرآن می گويد: «آنچه از شکم آن در می آيد در واقع نوشيدنی» است. بـعـد کارکـنان کـنـدو روی آن کار می کنند تا درصـد آب آن به 18 درصد می رسد و عسل سفـت می شود و هـمـيـنـطـور از آن نان درست می کنند.

3ــ عسل شفا بخش است:

چيزيکه فعلاً انسان از خواص طبی عسل می داند موارد زير است:

ــــ درصورت ماليدن عسلِ صاف به زخم، زيـچه ها (مـيکـروبها) را می کشد ومانع ازدياد آنهـا می شود وزخم زودتر بهبودی پيدا می کند.

ــــ برای دستگاه هاضمه شـفـابخش است.

ــــ دردهای روماتيزم را تخـفـيـف می دهد. 

ــــ به کودک کمک می کند که کـلسيم خود را حـفـظ کـند تا استخوان و دندانهای آن رشد کند. (توصيه شده به کودکان زير يک سال عسل داده نشود).

ــــ شفائی دور مدت برای برخی بيماريهای مزمن دارد.

ــــ برای التهاب حلق خوب است.

ــــ برای مفاصل خوب است.

خانه عـنکـبـوت

 

« کسانيکه بجای خـدا ديگران را ولی خود می کنند مانند عنکبوت می مانند کـه  خانه ای ساخت. براستی سست ترين خانه ها خانه عـنکبوت است، اگر می دانستند».

«اولياء» جمع ولی است و ولی بمعنی فاعلی و مفعولی می آيد بمعنی: کسيکه کسی را نزديکترين فرد به خود ميکند يا نزديکترين فرد بوی ميشود (برای طرح مسائل زندگی خود با وی يا تکيه نمودن بر وی و غيره).

نکات آيه:

1ــ آيه می گويد "اتخذت بيتاً: خانه ای ساخت". "اتخذت بيتاً"  صيغه ندرت ناميده می شود و انجام گهگاهی کاری را بيان می کند. و اين به اين معنی است که عنکبوت بطور گهگاهی برای خود خانه می سازد. پژوهشهائی که در زندگی عنکبوت شده نيز نشان می دهد که عنکبوت اغلب در سفر است و بطور گهگاهی برای خود خانه می سازد.

2ــ واژه "وَهن" بمعنی سست ضد "صلابت" بمعنی سفت و سخت ميباشد. آيه می گويد خانه عنکبوت سست ترين خانه ها است. يعنی اگر مثلاً به آن و به خانه هر موجود ديگری فوت کنيم، خانه عنکبوت کمترين مقاومت را نشان می دهد و از همه خانه ها متزلزل تر و آسيب پذير تر است. تا امروز انسان خانه ای سست تر از خانه عـنکـبوت نميشناسد. اگـر روزی خـانه ای سست تر از آن پـيـدا بشود قرآن ميسوزد. کـسـيکه در قـرن ششـم ميلادی (بيش 1400 سال پيش) دينی را از خود در ميآورد و همه دنيا را نگـشـتـه و خـانـه هـای هـمـه حيوانات و حشرات و غيره را نديده و نمی شناسد، هـيچگاه نمی آيد هـمه دين خود را در ايـن مـوضوع مايه بگذارد. روشن است که فـقط خداوند می تواند چنين مسائلی را با تأکيد مطرح کند. (حرف« اِنَّ » حرف تأکيد است).

3ــ نکته ديگر در آيه "وجه تشابه بين خانه سازی عنکبوت و کسانيکه بجای خدا ديگران را ولی خود ميکنند" می باشد. و آن اينست که عنکبوت از ماده شیمیائی بسیار قوی خود سست ترين خانه ها درست ميکند، کسانیکه بجای خدا دیگران را ولی خود می کنند نيز دنبال قویترینها هستند و قويترينها را دارند، و با قوی ترینها سست ترين حکومتها و روابط و مناسبات ها و مکاتب را درست می کنند. مانند آنچه بنام اردوگاه شرق شناخته می شد.

+ نوشته شده در  سه شنبه هشتم آبان 1386ساعت 9:9  توسط زارع زاده  | 

تست زيست سوم فصل 1و2و3

فصل 1

 

 

1- به طور معمول كدام يك از انواع گلبول هاي سفيد ترشح

مولكول هاي پروتئين از نوع گلبولين ها را به عهده دارد؟

1) لنفوسيت هايB        2) لنفوسيت هايT  

 3) گرانولوسيت ها         4) مونوسيت ها

 

3- در ارتباط با ويژگي هاي منوسيت ها ي خون گزينه ي صحيح كدام است؟

1) هسته چند بخشي- امكان ترشح سموم- حركت آميبي شكل     

2) هسته چند بخشي- قدرت بيگانه خواري- دياپدز

3) يك هسته اي- توان ترشح پادتن- حركت آميبي- بيگانه خواري

4) يك هسته اي- داشتن قدرت بيگانه خواري – دياپدز

 

4- تخريب و حل كردن ديواره سلولي ميكروب ها به عهده كدام سلول ها است؟

1) لنفوسيت هايB  2 ) لنفوسيت هايT    3) گرانولوسيت ها        4) مونوسيت ها

 

5- ماكروفاژ از لحاظ ساختار و فيزيولوژي به كدام سلول خوني شباهت بيشتري دارد؟پ

1) مونوسيت                2) لنفوسيت              3) گرانولوسيت                  4) اريتروسيت

 

6- كدام يك مسئول واكنش هاي آلرژيك مي باشد؟

1) مونوسيت             2) ائوزينوفيل              3) نوتروفيل                  4) لنفوسيت

 

7- كدام سلول ها مواد ضد ميكروب ترشح مي كنند؟

1) بشره پوست               2) لايه هاي مخاطي            

3) پلاكت هاي خون          4) گلبول هاي قرمز خون

 

8- ماكروفاژ ها از تغيير شكل كدام سلول ها به وجود مي آيند؟

1) لنفوسيت هاي          2) مونوسيت ها

3) گرانولوسيت ها             4) لنفوسيت هاي T

 

9- آنتي ژن ها را چه گروه مواد آلي تشكيل مي دهند؟

1) فقط پروتئين                       2) فقط هيدرات كربن             

3) پروتئين و هيدرات كربن         4) پروتئين و ليپيد

 

10- در مقابله با عفونت هاي باكتريايي كدام يك مهم تر است؟

1) ايمني سلولي              2) ايمني هومورال

) لنفوسيت هاي T             4) ماكروفاژها

 

11- پلاسموسيت ها از چه سلول هايي به وجود مي آيند؟

1) مونوسيت               2) گرانولوسيت         3) لنفوسيت        T4) لنفوسيت B

 

12- پس از ورود آلرژن به بدن انسان چه ماده اي از بعضي سلول ها ي بدن ترشح مي شود؟

1) آنتي هيستامين                   2) هيستامين              3) آنتي ژن                  4) پرفورين

 

13- سرمي كه جهت معالجه بيماري به انسان تزريق مي شود شامل چه ماده اي است؟

1) آنتي ژن توليد شده در انسان              2) آنتي ژن توليد شده در حيوان                                                          3) آنتي كور توليد شده در انسان              4) آنتي كور توليد شده در حيوان

 

14- منشأ لنفوسيتT كدام است؟

1) تيموس           2) مغز استخوان       3) سلول مادر        4) طحال

 

15- ماكروفاژ ها را در كجا به فراواني مي توان يافت؟

1) خون          2) پوست آسيب ديده       3) تيموس     4) طحال

 

16- در عمل فاگوسيتوز كدام يك مستقيماً دخالت ندارد؟

1) غشاي سلول     2) دستگاه گلژي    3 ) وزيكول      4) ليزوزوم

 

17- كدام يك مشابه گيرنده ي آنتي ژني لنفوسيتB است؟

1) پادتن                       2) آنتي ژن

3) پروتئين مكمل            4) گيرنده ي آنتي ژني پلاسموسيت

 

18- چه اندامكي در پلاسموسيت ها و سلول هايB خاطره تقريباً يكسان است؟

1) ريبوزوم ها                           2) ليزوزوم ها              

 3) شبكه آندوپلاسمي زبر          4) دستگاه گلژي

 

19- انتقال پادزهرها از مادر به جنين چه نوع ايمني است؟

1) غير فعال              2) فعال                 3) ذاتي                   4) غيراختصاصي

 

20- كدام يك معمولاً آزاد كننده هيستامين به شمار نمي رود؟

1) سلول هاي آسيب ديده              2) ماستوسيت            3) پلاسموسيت           4) بازوفيل

 

21- به كدام طريقه شخص سالم به ايدز مبتلا مي شود؟

1) نيش حشره آلوده            2) سوزن آلوده                                    

3) بزاق شخص آلوده            4) اشك شخص آلوده


فصل 2

 

22-مخچه تنظيم كدام عمل را به عهده دارد؟

1) فشار خون      2) زنش قلب         3) عمل بلع          4) تعادل بدن

 

23- دستگاه عصبي اتونوميك يا خودكار شامل اعصاب:

1) سمپاتيك و پاراسمپاتيك است.   2) منحصراً سمپاتيك است .

3) منحصراً پاراسمپاتيك است .       4) سينه اي و كمري نخاع است.

 

24- اثر اعصاب سمپاتيك و پاراسمپاتيك بر فعاليت قلب به ترتيب چگونه است؟

1) افزايش – كاهش          2) توقف – افزايش        3) كاهش – توقف             4) كاهش – افزايش

 

25- جهت هدايت پيام عصبي در بدن در يك نورون كدام است؟

1) از آكسون به جسم سلولي         2) از آكسون به دندريت

3) از دندريت به جسم سلولي      4) از جسم سلولي به دندريت

 

26- فعاليت هاي تعقلي منجر به استنتاج منطقي و ادراك از وظايف كدام بخش دستگاه عصبي است؟

1) بصل النخاع              2) مخچه              3) هيپوتالاموس               4) مخ

 

27- كدام ويژگي در تقسيم بندي سلول هاي عصبي دخالت ندارد؟

1) شكل زوايد سلولي        2) شكل جسم سلولي         

3) وجود يا عدم ميلين               4) تعداد قطب ها

 

29- نور اپي نفرين از كجاي نورون و براي چه ترشح مي شود؟

1) انتهاي آكسون – انتقال پيام عصبي

2) انتهاي دندريت – انتقال پيام عصبي

3) انتهاي آكسون – دريافت پيام عصبي                                

4) انتهاي دندريت – دريافت پيام عصبي

 

30- در هنگام پتانسيل عمل نفوذپذيري غشا نسبت به كدام يون زياد مي شود وچه وضعيتي دارد؟

1) +Na– موقتي                    2) +K – هميشگي         

3) +Na – هميشگي              4) +K – موقتي

 

31- سرعت هدايت موج عصبي در طول هر تار عصبي چگونه است و

 با قطر تار و وجود يا فقدان ميلين چه رابطه اي دارد؟      

1) متغير- مستقيم- با وجود ميلين سرعت بيش تر                       

2) ثابت – عكس – با فقدان ميلين سرعت بيش تر

3) ثابت – مستقيم – با وجود ميلين سرعت بيش تر                       

4) متغير- عكس – با فقدان ميلين سرعت بيش تر

 

32- انشعابات انتهايي آكسون داراي كدام ويژگي ذيل نمي باشد؟

1) قطورتر از جاهاي ديگر         2) حاوي ميتوكندي         

3) حاوي غلاف ميلين          4) حاوي كيسه هاي ترشحي

 

33- حفره هاي خوني كه از خون مغز پر مي شوند در كجاي پرده ي مننژ قرار دارند؟

1) بين نرم شامه و عنكبوتيه    2) بين عنكبوتيه و سخت شامه

3) در داخل نرم شامه     4) بين دو لايه سخت شامه

 

34- مايع مغزي- نخاعي در فاصله ي كدام دو پرده ي مغز قرار داشته و چه عملي انجام مي دهد؟

1) عنكبوتيه و نرم شامه – تغذيه لايه سطحي مغز                    

2) عنكبوتيه و نرم شامه – ضربه گير مراكز عصبي

3) عنكبوتيه و سخت شامه – ضربه گير مراكز عصبي              

4) عنكبوتيه و سخت شامه – تغذيه لايه سطحي مغز

 

35- عمل تغذيه سلول هاي سطحي مغز از كدام است؟

1) عنكبوتيه                 2) سخت شامه               

 3) نرم شامه              4) مايع مغزي نخاعي

 

36- گره نخاعي محل تجمع كدام يك مي باشد؟

1) اجسام سلولي نورون هاي حركتي ريشه شكمي                        

2) اجسام سلولي نورون هاي حسي ريشه شكمي

3) اجسام سلولي نورون هاي حركتي ريشه پشتي                          

4) اجسام سلولي نورون هاي حسي ريشه پشتي

 

37- در مورد انعكاس زردپي زير زانو كدام پاسخ صحيح نمي باشد؟

1) مسير انعكاس تك سيناپسي ماهيچه جلو ران را منقبض مي كند .         

2) ماهيچه عقب ران در مسير چند سيناپسي شل مي شود.

3) نوع نورون مربوطه آن حركتي بازدارنده است .

4) حاصل اين واكنش ها ساق پا را به جلو مي راند.

 

38- ماده خاكستري نخاع حاوي چه مي باشد؟

1) جسم سلولي نورون هاي رابط و حركتي و بدون ميلين

2) جسم سلولي نورون هاي حسي و حركتي و ميلين دار

3) جسم سلولي نورون هاي حركتي و بدون ميلين                           

4) جسم سلولي نورون هاي حسي و ميلين دار

 

39- پايين ترين بخش مغز كدام است؟   

1) دستگاه ليمبيك        2) پل مغزي         3) مخچه          4) بصل النخاع

 

40- در نوزاد انسان كه در هنگام راه رفتن دچار ناتواني مي باشد كدام يك از مراكز مغزي نارس است؟

1) دستگاه ليمبيك               2) قشر مخ                3) پل مغزي               4) مخچه

 

41- كدام يك از دستگاه هاي ذيل در تنظيم رفتارهاي هيجاني و عاطفي شركت دارد؟

1) هيپوتالاموس              2) دستگاه ليمبيك                 3) تالاموس                  4) مخچه

 

42- تعداد كدام يك از سلول هاي مغزي از بقيه بيش تر است؟

1) سلول هاي عنكبوتيه مخ        2) سلول هاي مهاجر به مخ       

3) سلول هاي نوروگلي مخ        4) نورون هاي مخ

 

43- اعصاب مغزي – نخاعي چند جفت هستند؟ 

1) 12           2) 31          3) 43            4) 23

 

44- در بخش جلويي و عقبي بالاي بصل النخاع به ترتيب كدام يك قرار دارد؟

1) برجستگي هاي چهارگانه – پل     2) برجستگي هاي چهارگانه – مخچه 

3) پل – مخچه                              4) مخچه -پل

فصل 3

 

45- كدام نوع سلول گيرنده عمدتاً مسئول بينايي در نور كم است و كدام نوع نسبت به نور حساسيت كمي دارد؟

 

1) استوانه اي ها – استوانه اي ها    2) استوانه اي ها – مخروطي ها 

3) مخروطي ها – مخروطي ها          4) مخروطي ها – استوانه اي ها

 

46- گيرنده هاي شيريني و تلخي به ترتيب در كجاي سطح زبان قرار دارند؟

1) عقب – طرفين             2) جلو – طرفين          3) عقب – جلو          4) جلو – عقب

 

47- قرنيه چشم حاصل تغييرات كدام يك از بخش هاي زير است؟

1) شبكيه                   2) صلبيه             3) عنبيه             4) مشيميه

 

48- تغذيه بافت هاي چشم به عهده كدام پرده است؟  

1) شبكيه     2) صلبيه      3) عنبيه         4) مشيميه

 

49- كدام نوع محرك به طور مستقيم سلول هاي مژك دار شنوايي

 را در بخش حلزوني تحت تأ ثير قرار مي دهد؟

1) الكتريكي            2) شيميايي               3) نوري            4) مكانيكي

 

50- براي اصلاح نزديك بيني و دوربيني به ترتيب از راست به چپ چه نوع عينكي لازم است؟

1) محدب – مقعر           2) مقعر – محدب           3) محدب – محدب              4) مقعر – مقعر

 

51- دو محيط شفاف چشم از خارج به داخل به ترتيب عبارتند از:

1) قرنيه – زلاليه                2) قرنيه – عدسي            

3) زلاليه – عدسي          4) عدسي – قرنيه

 

52- هرگاه قطر چشم در جهت محور نوري و تحدب عدسي بيش تر از حد معمول باشد كدام حالت است و چگونه اصلاح مي شود؟

 

1) نزديك بيني – عدسي محدب    2) نزديك بيني – عدسي مقعر

3) دوربيني – عدسي محدب         4) دوربيني – عدسي مقعر

 

53- كدام يك از انواع گيرنده ها سازش ناپذيرند؟ 

1) فشار       2) گرما          3) درد         4) سرما

 

54- عدسي چشم به وسيله رشته هايي به كجا وصل مي شود ودر كدام بيماري كدر مي شود؟

1) ماهيچه هاي مژكي – آب سياه     2) عنبيه – آب مرواريد

3) عنبيه – آب سياه          4) ماهيچه هاي مژكي – آب مرواريد

 

55- امكان تشخيص اشياي نزديك در تاريكي توسط وجود چه گيرنده هايي در موهاي سبيل گربه ميسر است؟

1) مكانيكي         2) شيميايي                3) نوري            4) دما

 

56- در كدام يك تصوير ايجاد شده در چشم از بخش هاي مختلف تشكيل شده است؟

1) پلاناريا              2) خرس               3) ملخ          4) گربه

 

57- از بين رفتن كدام يك باعث كري كامل مي شود؟

1) پرده صماخ           2) استخوان هاي گوش مياني                

3) مجاري نيم دايره               4) حلزون

 

58- گيرنده هايي در سرخرگ هاي گردن و در قوس آئورت وجود دارد كه نسبت به كاهش اكسيژن حساسند، اين گيرنده ها از چه نوع بايد باشند؟

1) مكانيكي                   2) شيميايي                  3) فشار                  4) لمس

 

 

فصل 4

 

59- مهم ترين هورمون تنظيم كننده ي قند خون كدام است؟  

1) آدرنالين         2) كورتيزول      3) انسولين         4) گلوكاگون

 

60- منبع ترشح ، ساختمان شيميايي و عمل آلدوسترون به ترتيب عبارتست از:

1) بخش قشري غده فوق كليه ، استروئيد ، بازجذب سديم در كليه   

2) بخش مركزي غده فوق كليه ، استروئيد ، بازجذب قند در كليه

3) بخش قشري غده فوق كليه ، پلي پپتيد ، باز جذب سديم در كليه  

4) بخش مركزي غده فوق كليه ، پلي پپتيد ، بازجذب قند در كليه

 

61- كدام هورمون از اتلاف سديم جلوگيري مي كند؟

1) آدرنالين                2) آلدوسترون                 3) كورتيزول                    4) گلوكاگون

 

62- نتيجه ي عمل هورمون كورتيزول بر مقدار گلوكز خون بر خلاف عمل كدام هورمون است؟

1) انسولين                2) آدرنالين                3) تيروكسين                 4) گلوكاگون

 

63- كمبود انسولين موجب كدام دو مورد مي شود؟

1) افزايش قند ادرار – كاهش حجم ادرار

2) كاهش قند ادرار – افزايش حجم ادرار

3) افزايش قند ادرار – افزايش حجم ادرار                                   

4) كاهش قند ادرار – كاهش حجم ادرار

 

64- كدام هورمون به پيك ثانوي نياز دارد؟

1) گلوكاگون            2) كورتيزول         3) آلدوسترون         4) استروژن

 

65- در انسان از دوره ي كودكي تا بلوغ وزن كدام غده به تدريج كم مي شود؟

1) هيپوفيز                   2) فوق كليه                   3) تيموس                   4) پ

+ نوشته شده در  دوشنبه هفتم آبان 1386ساعت 8:35  توسط زارع زاده  | 

شبيه سازي

● همه چیز درباره شبیه سازی

   شاید این روزها كه اخبار متفاوت و گسترده ای از كاربرد این تكنولوژی در رسانه ها می شنوید، كنجكاو شده باشید كه این كار چگونه انجام می شود و ثمرات آن چیست؟ این پرونده پاسخی است به كنجكاوی شما.

 

   اگر چه ممكن است كمی عجیب به نظر برسد ولی بد نیست بدانید كه موجودات شبیه سازی شده، همیشه در میان ما وجود داشته اند. البته نساخته شده در آزمایشگاه و با استفاده از تكنولوژی ، بلكه منظورهمان دوقلوهای مشابهی است كه به طور طبیعی خلق شده اند.

 

   شاید شما اولین بار نام تكنولوژی شبیه سازی را زمانی كه گوسفندی به نام دالی در سال ۱۹۹۷ با استفاده از این تكنولوژی به دنیا آمد شنیده باشید ولی بشر از مدتها قبل از به دنیا آمدن دالی، از این تكنولوژی استفاده كرده است.

 

   حدود ۵ هزار سال قبل از میلاد مسیح، انسانهای اولیه متوجه شدند اگر دانه هایی را كه توسط گیاهان غنی تر و مقوی تر تولید می شوند، بكارند، می توانند پس از مدتی عین همان غله غنی و مقوی را برداشت كنند. این كار اولین قدم در دستكاری زندگی یك موجود زنده برای برآوردن نیازهای انسانی بود. موضوعی كه هدف اصلی و نهایی شبیه سازی است.

 

   پس از گذشت حدود ۷ هزار سال و پیشرفت روزافزون علم، دانشمندان به فكر همانندسازی مهره داران افتادند. سال ۱۹۵۲، دو دانشمند به نامهای رابرت بركینز و توماس كینگ موفق به شبیه سازی بچه قورباغه هایی شدند كه درست مثل حیوان اصلی و اولیه بودند. این بچه قورباغه های كوچك به عنوان نخستین حیوانات شبیه سازی شده در تاریخ مشهورند. پس از آن تحقیقات در این زمینه سرعت بیشتری گرفت.

 

   سال ۱۹۹۶ و پس از گذشت چیزی حدود ۴۴ سال، تلاشهای وسیع دانشمندان برای تولید اولین پستاندار شبیه سازی شده به نتیجه رسید و گوسفندی به نام دالی در جولای آن سال به دنیا آمد. این كاررا دكتر جان ویلموت و همكارانش در موسسه روزالین اسكاتلند و با استفاده از هسته یك سلول از سلولهای پستانی یك میش بالغ و جایگزین كردن آن با هسته یك سلول تخمك انجام دادند. در همین زمان و با بروز نگرانیهایی در جامعه از امكان شبیه سازی انسانی و خطرات ناشی از آن، بیل كلینتون رئیس جمهور وقت آمریكا دستورالعمل ممنوعیت استفاده از بودجه های دولتی برای انجام تحقیقات شبیه سازی انسانی را صادر كرد.

 

   با این وجود، سال ۲۰۰۱ دكتر پانابیوتیس زاووس از متخصصان مشهور باروری در آمریكا و تیم تحقیقاتی وی اعلام كردند كه صدها نفر از مردم برای انجام آزمایش به منظور تولید بچه های شبیه سازی شده داوطلب شده اند. این موضوع باعث شد تا سایر كشورها نیز به فكر قانونمند كردن عمل شبيه سازي انسان بیفتند.

   در این میان، انگلستان اولین كشوری بود كه عمل شبیه سازی انسان را به طور موثری قانونمند كرد البته طی این مدت ، تولید سایر حیوانات شبیه سازی شده در كشورهای مختلف ادامه یافت و حیواناتی نظیر اسب، گاو، موش، سگ و گربه همانندسازی شدند. سال ۲۰۰۳، اولین پستاندار به دنیا آمده با استفاده از تكنولوژی همانندسازی یعنی دالی در ۶ سالگی و به دلیل ابتلا به یك بیماری ریوی با انجام تزریق كشنده فوت كرد، ولی تكنولوژی همانندسازی همچنان راه خود را ادامه میدهد.

 

● اسرار شبيه سازی

   برای انواع مختلف شبیه سازی، تكنولوژی های متفاوتی وجود دارد. تكنیك انتقال هسته سلول سوماتیك (ScNT) تكنیكی است كه بیشتر از همه برای شبیه سازی تولید مثلی پستانداران استفاده میشود. در این روش موجود تولید شده، همان مواد ژنتیكی هستهای حیوان اولیه را خواهد داشت.

 

   دالی، اولین پستاندار شبیه سازی شده، با استفاده از تكنولوژی انتقال هسته سلول سوماتیك به دنیا آمد. برای فهم بهتر این تكنولوژی باید مروری به سیستم تولید مثل در موجودات زنده داشته باشیم. در بدن هر پستاندار زنده، تخمك در جنس مونث و اسپرم در جنس مذكر، تنها سلولهایی هستند كه نقش تولید مثلی دارند و به عنوان سلولهای تولید مثلی یا سلولهای جنسی معروفند. به تمامی سلولهای غیر از آنها، سلول سوماتیك یعنی سلول غیرتولید مثلی یا سلول بدنی گفته می شود.

 

   هر سلول سوماتیك دارای دو سری كامل از كروموزومهاست، در حالی كه سلولهای تولید مثلی هر كدام فقط یك سری دارند. پس از لقاح و آمیزش، اسپرم و تخمك با هم یكی میشوند و سلول تخم را به وجود می آورند. سلول تخم، دارای دو سری كامل از كروموزومهاست كه یك سری را از اسپرم (پدر) و یك سری را از تخمك (مادر) گرفته است.

 

  برای ساختن دالی با استفاده از تكنولوژی انتقال هسته سلول سوماتیك، دانشمندان یك سلول سوماتیك را از بافت پستان یك گوسفند بالغ جدا كردند. آنها سپس هسته آن سلول را به یك سلول تخمكی كه هستهاش را قبلا برداشته بودند، منتقل كردند.

 

   هسته هر سلول در حقیقت مغز یك سلول را تشكیل میدهد و حاوی تمام مواد ژنتیكی و اطلاعاتی است كه سلولها برای زندگیشان لازم دارند. درواقع تفاوت در همین مواد ژنتیكی است كه موجب میشود هر كدام از ما منحصر به فرد بوده و با سایرین تفاوت داشته باشیم.

 

   در مرحله بعد، دانشمندان سلول تخمك را - كه دارای هسته جدید (از سلول دهنده) است - به كمك مواد شیمیایی و جریان الكتریكی به تقسیم سلولی تحریك كردند. پس از چند تحریك شیمیایی، سلول تخمك با هسته جدیدش درست شبیه سلول تخمی كه به تازگی بارور شده باشد، عمل كرد. بعد از آنكه رویان شبیه سازی شده به مرحله مناسب و خوبی رسید، آن را به رحم یك میزبان ماده منتقل كردند تا در آنجا به تكاملش تا هنگام تولد ادامه دهد.

 

   در نهایت، دالی به همین ترتیب در سال ۱۹۹۶ به دنیا آمد. او یك كپی ژنتیكی دقیق و كامل از گوسفند ماده بالغی بود كه هسته سلول سوماتیك اش را جایگزین هسته یك سلول تخمك كرده بودند. دالی اولین پستانداری بود كه از یك سلول سوماتیك بالغ شبیه سازی شده بود.

 

   نكته مهمی كه دانشمندان به آن اشاره می كنند، این است كه دالی یا هر موجود دیگری كه با استفاده از تكنولوژی انتقال هسته ای تولید شده، ۱۰۰ درصد مشابه موجود اولیه نیست. این شباهت چیزی در حد ۹۹/۷ درصد است، زیرا در این تكنولوژی تنها هسته سلول دهنده وارد تخمك بدون هسته میشود، حال آنكه مقداری از مواد ژنتیكی مهم در خارج از هسته و داخل میتوكندریها وجود دارند.

 

   میتوكندریها قسمتی از سلول هستند كه خارج از هسته و داخل سیتوپلاسم یك سلول قرار دارند و به عنوان منابع تولید قدرت، انرژی و متابولیزم سلولی عمل میكنند. میتوكندریها دارای قطعات كوچكی از DNA هستند و برخی از مواد ژنتیكی در فرآیند شبیه سازی از میتوكندریهای سیتوپلاسم میآیند. اینكه این موضوع به چه مقدار تغییرات در یك موجود شبیه سازی شده منجر میشود، در حال بررسی است.

 

● شبیه سازی با روش های معمولی تولید مثل چه تفاوتی دارد؟

   بارور شدن یك تخمك به وسیله یك اسپرم (روش معمولی تولید مثل) و روش انتقال هسته سلول سوماتیك هر دو منجر به یك نتیجه میشوند و آن به وجود آمدن رویان است. یك رویان از سلولهایی كه دو سری كامل كروموزوم دارند، تشكیل شده است. تفاوت این دو روش در منشا آن دو سری كروموزوم است.

   در باروری معمولی، اسپرم و تخمك هر كدام دارای یك سری كروموزوم هستند و زمانی كه این دو به هم متصل میشوند، تخم بارور دارای رشته های كروموزومی خواهد بود كه یك سری از پدر (اسپرم) و یك سری از مادر (تخمك) گرفته شدهاند ولی در روش انتقال هسته سلول سوماتیك برای انجام شبیه سازی، هسته سلول تخمك - كه دارای تنها یك سری از كروموزومها است - برداشته و با هسته سوماتیك - كه دارای دو سری كامل از كروموزومهاست ، جایگزین میشود. بنابراین، رویان حاصل شده از این روش هر دو سری كروموزمهایش را فقط از یك سلول سوماتیك منفرد گرفته است.

 

● شبیه سازی چه خطراتی دارد؟

   شبیه سازی تولید مثلی موجودات زنده در حال حاضر یك عمل گران و غیرموثر است. بیش از ۹۵ درصد تلاشهای شبیهسازی برای تولید یك موجود زنده شكست میخورند و ممكن است بیش از ۱۰۰ فرآیند انتقال هستهای برای تولید یك موجود شبیهسازی شده، لازم باشند. دالی پس از ۲۷۶ مرتبه تلاش برای عوض كردن هسته تخمك، به دنیا آمد. این ۲۷۶ تخمك در مجموع ۲۹ رویان تولید كردند و از میان آنها تنها دالی زنده ماند.

 

   علاوه بر این، تنها ۷۰ گوساله پس از ۹هزار مرتبه تلاش برای همانندسازی به دنیا آمدند. یك سوم از این گوساله ها طی مدت كوتاهی جان خود را از دست دادند و بسیاری از آنها در هنگام مرگ به طور غیرعادی بزرگ بودند. بد نیست بدانید كه اولین اسب شبیه سازی شده یعنی پرومته پس از ۳۲۸ بار تلاش به دنیا آمد.علاوه بر شانس موفقیت كم، بررسی ها نشان داده اند حیوانات همانندسازی شده غالبا عملكرد ایمنی مختل شده بیشتر و میزان بالاتری از ابتلا به انواع عفونت، سرطان و سایر اختلالات را دارند.

 

  برخی دانشمندان علت مرگ اولین پستاندارد شبیه سازی شده (دالی) را پیری زودرس ناشی از شبیه سازی می دانند ولی دكتر یان ویلموت معتقد است كه مرگ زودرس دالی ارتباطی با شبیه سازی نداشته و به دلیل یك عفونت تنفسی شایع در میان گوسفندها بوده است.یك مشكل اصلی در شناخت عواقب شبیه سازی آن است كه متاسفانه بسیاری از حیوانات شبیه سازی شده به اندازه كافی زنده نمانده اند. این موضوع باعث شده است تا دانشمندان اطلاعات كافی در مورد اینكه حیوانات شبیه سازی شده چگونه زندگی كرده و پیر می شوند، به دست بیاورند.سالم به نظر رسیدن در سن كم به تنهایی یك نشانه خوب برای بقای طولانی مدت موجودات شبیه سازی تلقی نمی شود.

 

   در حقیقت این حیوانات به دلیل مردن اسرارآمیزشان شهرت دارند. به عنوان مثال، نخستین گوسفند شبیه سازی شده استرالیایی پیش از مرگ كاملا سالم و سرحال به نظر می رسید و نتایج كالبدشكافی ها نتوانستند علت مرگش را مشخص كنند.

  

   در سال ۲۰۰۲، پژوهشگران موسسه وایتهد در ماساچوست آمریكا اعلام كردند كه رگهای موشهای همانندسازی شده دارای اشكالاتی هستند. آنها در تجزیه و تحلیل بیش از ۱۰/۰۰۰ سلول كبد و جفت موشهای همانندسازی شده، متوجه شدند كه در حدود ۴ درصد از عملكرد ژنها غیرعادی بوده است. به عقیده دانشمندان تغییراتی در فعالیت طبیعی آنها و یا بروز یك سری ژنهای خاص علت بروز این اشكالات هستند.

 

   یك مشكل دیگر به ویژه در مورد همانندسازی گونه های منقرض شده آن است كه در این موارد به طور طبیعی نمونه منفرد شبیه سازی شده به تنهایی قادر به خلق یك جمعیت بارور كننده دیگر نخواهد بود. علاوه بر این، حتی در صورتی كه هر دو جنس مذكر و مونث آن موجود زنده وجود داشته باشند، معلوم نیست كه آیا آنها در غیاب والدینی كه بایستی به آنها رفتار طبیعی شان را بیاموزند قادر به زندگی خواهند بود یا خیر.غیر از موارد فوق، ممكن است همانندسازی برخی از حیوانات منقرض شده نظیر دایناسورها در آینده دور خطرات بالقوه زیادی را برای انسانها داشته باشند. فیلم پارك ژوراسیك كه صرفا یك فیلم علمی - تخیلی بود مو را بر تن راست میكرد. حال فكر كنید اگر این علم و تخیل به واقعیت تبدیل شود چه اتفاقاتی ممكن است در جهان روی دهد.

 

● شبیه سازی حیوانات منقرض شده

   كسانی كه كتاب پارك ژوراسیك را خوانده و یا فیلم آن را دیده اند بیشتر از سایرین با این مورد استفاده شبیه سازی آشنایی دارند. بازسازی مواد ژنتیكی گونه های منقرض شده از مدتها قبل مدنظر دانشمندان بوده است. یكی از مواردی كه اخیرا دانشمندان در حال كار بر روی آن هستند، یك نوع ماموت پشمالو است.

متاسفانه تلاشها برای گرفتن مواد ژنتیكی از ماموتهای یخ زده تاكنون موفقیتآمیز نبوده اند. مشكل اصلی این است كه در این گونه موارد سلول تخمك و رحمی كه قرار است سلول همانندسازی شده در آن كاشته شوند از گونه های متفاوتی هستند. این موضوع امكان موفقیت عمل شبیه سازی را بسیار مشكل ساخته است. علاوه بر این، برای همانندسازی گونه های منقرض شده باید یك DNA سالم و كامل وجود داشته باشد. با این وجود درحال حاضر یك تیم روسی ـ ژاپنی در حال بررسی و كار بر روی همانندسازی ماموتها هستند.

 

● استفاده از تكنولوژی شبیه سازی درمانی در انسان

   ممكن است روزی از تكنولوژی شبیه سازی درمانی در انسانها برای تولید اعضای بدن از یك سلول استفاده شود. همچنین شاید بتوان با كمك این تكنولوژی سلولهای سالمی را تولید و آنها را جایگزین سلولهایی كه در اثر بیماریهای تحلیل برنده مثل آلزایمر یا پاركینسون خراب شده اند ،كرد. دانشمندان امیدوارند روزی بتوانند از شبیه سازی درمانی برای تولید اعضا و بافتها به منظور پیوند استفاده كنند. برای انجام این عمل، DNA باید از فردی كه به پیوند نیاز دارد گرفته شده و وارد یك سلول تخمك بدون هسته شود. پس از تقسیم تخمك حاوی مواد ژنتیكی بیمار، سلولهای بنیادی حاصله كه قابلیت تبدیل به هر گونه بافتی را دارند كشت داده می شوند.

 

   این سلولها برای تولید یك عضو یا بافت كه كاملا با گیرنده سازگار است استفاده می شود. از نظر تئوری، عضو شبیه سازی شده را میتوان بدون ترس از خطر رد شدن آن به همان بیمار پیوند كرد.در صورت تولید اعضای بدن با استفاده از روباتهای همانندسازی شده انسانی، نیاز برای گرفتن آن عضو از فرد دیگر و خطر رد شدن پیوند به میزان قابل توجهی كاهش خواهند یافت. البته در حال حاضر نگرانیها و چالشهای زیادی درباره این مسأله وجود دارند كه باید قبل از آنكه انجام پیوند با استفاده از اعضای شبیه سازی به یك واقعیت تبدیل شود كاملا برطرف گردند. امروزه تحقیقات بسیاری برای تكامل سلولهای خاص به منظور تبدیل به انواع بافتها كه بتوانند سلولهای عصب، عضله و یا سایر انواع سلولی را ساخته و در بیماریهای پاركینسون، آلزایمر، بیماریهای قلبی و سایر بیماریهای مزمن استفاده شوند، در حال انجامند.

 

● شبیه سازی انسان

    طی چند سال گذشته و پس از موفقیت اولیه شبیه سازی در حیوانات، دانشمندان به فكر انجام شبیه سازی در انسان افتادند. این موضوعی بود كه از مدتها قبل فكر دانشمندان را مشغول كرده بود.به طور كلی شبیه سازی در انسان دو جنبه دارد؛ یكی جنبه تولید مثلی و دیگری جنبه درمانی.

 

● جنبه تولید مثلی شبیه سازی انسانی

   منظور از جنبه تولید مثلی یعنی به وجود آمدن انسانی كه كاملا شبیه به انسان دیگری باشد. جنبه تولید مثلی شبیه سازی در اكثر كشورها ممنوع اعلام شده است. اگرچه ممكن است شبیه سازی انسان در مواردی مثل شبیه سازی یك كودك به منظور جایگزینی یك عزیز از دست رفته برای پدر و مادر كه فرزند خود را از دست داده اند، بتواند تسكینی برای غم آنها باشد ولی با توجه به غیر موثر بودن شبیه سازی پستانداران (فقط ۱-۲ مورد موفقیت در هر ۱۰۰ آزمایش)، كمبود دانش لازم در این زمینه و وجود بسیاری از موارد اخلاقی در مورد شبیه سازی، بسیاری از دانشمندان و پزشكان قویا باور دارند كه شبیه سازی انسان كار، كاملا غیرعملی است.نه تنها اكثر تلاشها برای شبیه سازی پستانداران شكست می خورند بلكه در حدود ۳۰ درصد از مواردی كه زنده به دنیا می آیند به برخی از وضعیت های ناتوان كننده مبتلا هستند.

 

   به همین صورت میتوان مشكلات مشابهی را در مورد شبیه سازی انسانی انتظار داشت. با توجه به مجهولات بسیاری كه در مورد علم شبیه سازی وجود دارند تلاش برای شبیه سازی انسانها در حال حاضر بسیار خطرناك و از نظر اخلاقی غیرقانونی در نظر گرفته می شود.شاید یك مشكل اصلی در شبیه سازی انسان به مسائل تكاملی مربوط شود. در حالت تولید مثلی طبیعی، اسپرم با تخمك لقاح میكند. برای تكامل غدد جنسی انسان و تولید اسپرم و تخمك مدت زمان زیادی لازم است. ولی در حالت شبیه سازی تولید مثلی، این روند تنها در طی دقیقهها و شاید ساعت ها انجام میشوند. بنابراین روند تولید مثلی و توانایی برای تولید مثل در شبیه سازی بسیار تسریع شده است كه ممكن است عامل یك سری از مشكلات باشد.

 

● جنبه درمانی شبیه سازی انسان

   منظور از جنبه درمانی شبیه سازی انسانی یعنی تولید رویان های انسانی برای اینكه از سلولهای پایه آنها به منظور تحقیق و درمان برخی از بیماریهای صعب العلاج استفاده شود. از نظر جنبه درمانی، شبیه سازی انسانی از مدت ها قبل انجام می شد.

 

    دانشمندان دانشگاه نیوكاسل انگلستان سال قبل اعلام كردند كه نخستین رویان انسانی را تا حدی شبیه سازی كردهاند و با توجه به آنكه شبیه سازی درمانی دارای یك پتانسیل بزرگ برای درمان بسیاری از بیماریها و ناتوانایی های خاص است. برخی كشورها انجام آن را تحت شرایطی مجاز اعلام كردهاند. در كشور انگلستان در سال ۲۰۰۱ قانونی تصویب شد كه شبیه سازی تولید مثلی را ممنوع كرد. این قانون، انجام شبیهسازی درمانی را منوط به كسب اجازه از موسسه جنین شناسی و باروری انگلستان میداند.

   تیم تحقیقاتی دانشگاه نیوكاسل انگلستان تخمكهای ۱۱ زن را گرفته، ماده ژنتیكی آنها را با DNA سلولهای بنیادی جنینی جایگزین كردند. هدف آنها از انجام این كار (كه در معرض انتقادات شدیدی نیز قرار دارد) ساختن رویان های شبیه سازی شده است كه بتوان از سلولهای بنیادی آنها برای درمان بیماریهای صعب العلاج استفاده كرد. سلولهای بنیادی در حقیقت سلولهایی هستند كه در رویانهای انسانی كه در مراحل اولیه قرار دارند، وجود داشته و قابلیت تكامل و تبدیل به انواع بافتهای بدن را دارند. در این صورت، این سلولها كاملا با فرد بیمار سازگار بوده و میتوان از آنها بدون وجود مشكلی از نظر رد شدن پیوند برای درمان بیماریهایی مثل دیابت، پاركینسون آلزایمر و یا پیوند یك عضو استفاده نمود.به عنوان مثال، در صورت پیشرفت و تكامل تكنولوژی، فردی كه نیاز به پیوند كلیه دارد میتواند یك سلول از بدن خود را شبیه سازی كرده و پس از رسیدن به مرحله رویانی، از آن برای تولید كلیه ای كه با وی كاملا سازگار است استفاده كرد.

 

   البته گونه های مختلفی از سلولهای بنیادی وجود دارند ولی دانشمندان معتقدند كه مفیدترین و موثرترین آنها از بافت جنینی به دست میآیند.در تحقیق دانشگاه نیوكاسل، ۳ مورد از رویانهای شبیه سازی شده در آزمایشگاه به مدت ۳ روز و یك مورد به مدت ۵ روز رشد كردند. به عقیده آنها، عامل مهم در موفقیت عمل شبیه سازی، سرعت جمعآوری و دستكاری تخمك است. پروفسور آیسون (كه رهبری این تحقیق را به عهده دارد) و همكارانش متوجه شدند رویانی كه به مدت ۵ روز باقی مانده بود در طی تنها ۱۵ دقیقه جمعآوری و دستكاری شده بود. البته پژوهشگران معتقدند هنوز راه بسیار زیادی تا موفقیت كامل باقی مانده است.

 

● شبیه سازی به چه درد می خورد؟

   استفاده از تكنولوژی شبیه سازی تولید مثلی در حیوانات به منظور تولید گونه هایی كه دارای تواناییهای خاص هستند. به عنوان مثال، میتوان حیواناتی را به وجود آورد كه تولید كننده دارو یا آنتی بادی علیه بیماریها باشند. همچنین به كمك تكنولوژی شبیه سازی میتوان برخی گونه های حیوانی را از نظر ژنتیكی به صورتی تغییر داد تا بتوانند مدلی برای تحقیق درباره بیماریهای انسانی باشند.

 

   البته برای رسیدن به این منظور باید شانس موفقیت شبیه سازی بالا برده شود. تكثیر حیوانات و شكل های در معرض خطر انقراض و یا حیواناتی كه باروری آنها مشكل است.در سال ۲۰۰۱، نخستین شبیه سازی از یك گونه گاو وحشی هندی كه در معرض خطر انقراض است انجام شد. این گاو وحشی ۴۸ ساعت پس از تولد در اثر عفونت درگذشت. در همان سال دانشمندان ایتالیایی یك نوع قوچ كوهی كمیاب را همانندسازی كردند. این قوچ در حال حاضر در یك مركز حیات وحش در ساردنی ایتالیا زندگی می كند. غیر از موارد فوق، گونه های در معرض خطر دیگری نیز كاندید انجام عمل شبیه سازی هستند. از جمله میتوان به یك نوع بزكوهی نادر آفریقایی، ببرسوماترا و پاندای بزرگ اشاره كرد.بد نیست بدانید كه در حال حاضر یك باغ وحش یخ زده در آمریكا وجود دارد كه محل جمع آوری و نگهداری بافتهای یخ زده گونه های نادر و یا در معرض خطر انقراض دنیاست.

 

● باغ وحش حیوانات شبیه سازی شده

 

▪ بچه قورباغه:

 سال ۱۹۵۲ نخستین بچه قورباغه ها با استفاده از روش انتقال هسته سلولی سوماتیك از سوی رابرت بریكز و توماس كینگ به وجود آمدند.

 

▪ ماهی كپور:

 سال ۱۹۶۳، یك رویان شناس چینی به نام تانگ دیژو موفق شد یك ماهی كپور را شبیه سازی كند. وی نتایج تحقیقاتش را در یك مجله علمی چینی نه چندان معروف چاپ كرد. نتایج تحقیقات آقای ویژو هرگز به انگلیسی ترجمه نشد.

 

▪ گوسفند:

 جولای سال ۱۹۶۶، دالی با تلاش بان ویلموت و همكارانش در موسسه روزلین اسكاتلند به دنیا آمد.

 

▪ خوك:

 ماه مارس سال ۲۰۰۰، ۵ بچه خوك اسكاتلندی شبیه سازی شدند.

 

▪ گاو وحشی هندی:

 یك نوع گاو وحشی هندی به نام نوآه در ژانویه سال ۲۰۰۱ به دنیا آمد.

 

▪ گاو معمولی:

 سال ۲۰۰۱، دو گاو به نامهای میلی و اما در دانشگاه تنسی آمریكا شبیه سازی شدند.

 

▪ گربه :

  نخستین گربه شبیه سازی شده ،  سال 2001 میلادی در دانشگاه دامپزشکیA&M تگزاس آمریکا تولید شد و سی سی نام دارد . اين گربه 3 قلو زایید و بار دیگر شگفتی ساز شد. دو تا از بچه گربه ها شبیه مادرشان هستند و قل سوم، همانند پدرش دودی است. سی سی مخفف Copy Cat است .

 

▪ موش:

   نخستین بار، سال ۱۹۹۷ در آزمایشگاه ریوزو یافاكیماچی در دانشگاه هاوایی همانندسازی شد. ۵ سال بعد یعنی سال ۲۰۰۲، بیش از یك دوجین موش با استفاده از همانندسازی متولد شدند.

 

▪ خرگوش:

  فرانسه و كره شمالی در ماه های مارس و آوریل سال ۲۰۰۳ به طور جداگانه همانندسازی خرگوش را انجام دادند.

 

▪ قاطر:

  ماه می ۲۰۰۳ نخستین قاطر همانندسازی شده به نام ایداهوجم به دنیا آمد.

 

▪ گوزن:

نخستین گوزن شبیه سازی شده به نام دووی در سال ۲۰۰۳ متولد شد.

 

▪ اسب:

 دانشمندان ایتالیایی اسبی به نام پرومته را در سال ۲۰۰۳ با استفاده از شبیه سازی به دنیا آوردند.

 

▪ موش صحرایی:

 اولین موش صحرایی به نام رالف در سال ۲۰۰۳ متولد شد.

 

▪ سگ:

 دانشمندان كره جنوبی یك سگ شكاری افغان به نام اسناپی را در سال ۲۰۰۵ شبیه سازی كردند.

 

● دالی، نخستین پستاندار شبیه سازی شده

   دالی ساعت ۵ بعدازظهر روز پنجم جولای سال ۱۹۹۶ به دنیا آمد. به دنیا آمدن دالی تا مدتی به دلیل زمان لازم برای ثبت امتیاز اكتشاف به عمل آمده مخفی نگاه داشته شد. دالی در واقع از سلولهای پستانی منجمد شده یك گوسفند - كه سالها پیش مرده بود – به وجود آمد. در حقیقت، دالی دوقلوی یكسان همان گوسفندی بود كه مدتها قبل مرده بود. آوریل سال ۱۹۹۸، در نتیجه آمیزش طبیعی دالی با یك قوچ از نژاد ولش مانتیشن به نام دیوید برهای به نام بونی متولد شد. در سال ۱۹۹۹ سه بره دیگر نیز به دنیا آمدند. دالی سال ۲۰۰۲ به ورم مفاصل و یك بیماری ریوی پیشرونده مبتلا شد و دامپزشكان مجبور شدند برای كاهش رنج وی با یك تزریق كشنده در ۱۴ فوریه سال ۲۰۰۳ به زندگی وی خاتمه دهند.

نهم آوریل سال ۲۰۰۳، بدن وی به موزه رویال ادینبورگ - كه قسمتی از موزه های ملی اسكاتلند است - منتقل شد.

 

● پرونده اخلاقی شبیه سازی

   شبیه سازی دالی در سال ۱۹۹۷ نگرانیهای اخلاقی زیادی را در مورد شبیه سازی انسان برانگیخت. این نگرانیها حتی در مورد شبیه سازی درمانی انسان به منظور مداوای بیماریهای صعب العلاج نیز وجود داشتند. طرفداران تكنولوژی شبیه  سازی درمانی معتقدند كه آزمایش ها خیلی قبل از آنكه یك رویان بتواند شروع به تكامل هر گونه سیستم عصبی كند، انجام می شوند و به همین دلیل، نمیتوان آنها را به عنوان دخالت در سرنوشت یك زندگی انسانی تلقی كرد. به باور آنها، شبیه سازی درمانی در صورت پیدا كردن درمانهای موِثر و مفید برای بیماریهای ناتوان كننده می تواند یك عمل بسیار مهم و حیاتی باشد.

 

   ولی مخالفان عقیده دارند یك رویان صرفنظر از مرحله تكاملی اش هنوز بالقوه یك انسان است كه در مراحل اولیه تكاملش قرار دارد. به باور بسیاری از آنها، زندگی یك انسان از زمانی كه یك تخمك با یك اسپرم لقاح می كند، شروع می شود. غیر از این، تكنولوژی های شبیه سازی هنوز در حیوانات شبیه به انسان نظیر برخی میمونها موِثر نبوده اند و خطرات زیادی در این زمینه وجود داشته اند.

 

● مذهب علیه شبیه سازی

   برخی مذاهب عقیده دارند كه شبیه سازی انسان در واقع دخالت در اراده خداوند و تغییر سیر طبیعی زندگی یك انسان است. بسیاری از مذاهب معتقدند كه روح در لحظه لقاح اسپرم و تخمك وارد بدن میشود و بنابراین كشت سلولها برای شبیه سازی به منزله دخالت در خلقت طبیعی یك انسان است. به گفته پاپ ژان پل دوم، تكنیكهای شبیه سازی انسانی از آن جهت كه در آنها دستكاری و تخریب رویان های انسانی وجود دارند ، از نظر اخلاقی قابل قبول نیستند ، حتی اگر هدف دانشمندان از انجام این كار یك هدف نیكو و پسندیده و به منظور كمك به نوع بشر باشد. همچنین آقای دیمتری دموپولوس، پیشوای روحانی ارتودوكسهای یونان نیز با هر گونه تلاش برای شبیه سازی انسانها مخالف است. به باور وی انسانها باید در اثر یك عشق پاك بین دو نفر به وجود آیند نه از طریق دستكاری سلولها در آزمایشگاه.

 

   كشورهای مختلف دیدگاه های متفاوتی نسبت به جنبه های گوناگون شبیه سازی انسانی دارند. در سال ۱۹۹۷، كمیته اخلاقی زیستی آمریكا از بیل كلینتون رئیس جمهور سابق این كشور خواست كه قانونی را برای محدودیت شبیه سازی انسانی وضع كند. براساس این قانون كه مورد حمایت انجمن پزشكان آمریكا نیز قرار دارد، پرداخت هرگونه بودجه دولتی برای تحقیق درباره شبیه سازی انسانی ممنوع است. این كار به طور موِثری از تحقیق در موِسسه های ملی و دانشگاه هایی كه از بودجه دولتی استفاده می كنند، جلوگیری می كند.انجمن پزشكان آمریكا به دلیل وجود مواردی مثل آسیبهای جسمی در اثر شبیه سازی، آسیبهای روانی - اجتماعی، اثرات شبیه سازی انسان بر خانواده و جامعه و اثر بر تنوع ژنتیكی با شبیه سازی انسانی مخالف است. علاوه بر این، جرج بوش رئیس جمهور كنونی آمریكا نیز با هر گونه شبیه سازی انسانی اعم از تولیدمثلی و درمانی مخالف است.

   برخی از ایالت های آمریكا نیز هر دو نوع شبیه سازی را ممنوع كرده اند در حالی كه برخی دیگر تنها با نوع تولیدمثلی مخالفند.در انگلستان قانونی وجود دارد كه به دانشمندان اجازه می دهد تا با كسب اجازه از موِسسه رویان شناسی و باروری انسانی به انجام شبیه سازی درمانی بپردازند ولی انجام شبیه سازی تولیدمثلی انسان قویا ممنوع شده است. محققان دانشگاه نیوكاسل انگلستان نخستین دانشمندانی بودند كه در ۱۱ آگوست ۲۰۰۴ این اجازه را برای تحقیق درباره درمان بیماریهایی نظیر دیابت، پاركینسون و آلزایمر دریافت كردند البته این قانون تصریح می كند كه رویانهای استفاده شده برای تحقیق باید پس از اتمام كار تخریب شوند. در این مرحله، آنها هنوز در یك مرحله زودرس تكاملی قرار دارند.علیرغم تمامی مسائل فوق، علم شبیه سازی در جهان امروز همواره به عنوان یك موضوع مهم و قابل بحث مطرح بوده و در این مورد بحثهای زیادی به طور متناوب بین مذاهب، سیاستمداران، دانشمندان، خبرگزاریها و مردم عادی جامعه مطرح می شوند.

 

● ایران شبیه سازی می كند

   چندی پیش دانشمندان عزیز كشورمان كه تصمیم گرفته اند در هیچ زمینه علمی از دانش روز دنیا عقب نمانند، موفق شدند نخستین گوسفند شبیه سازی شده خاورمیانه را زنده به دنیا بیاورند. این اقدام گام بلندی در عرصه تحقیقات تكنولوژیك برای دانشمندان ماست. این گوسفند در ساعت ۱۰ شب چهارشنبه یازدهم مردادماه در پایگاه تحقیقاتی رویان اصفهان متولد شد ، ولی متأسفانه علیرغم تلاشهای فراوان دامپزشكی به دلیل عوارض زایمانی و مشكلات تنفسی نتوانست بیش از چند دقیقه زنده بماند.

 

   مرگ این گوسفند مسأله قابل انتظاری است كه سایر مراكز تحقیقاتی دنیا نیز با آن مواجه می شوند ، ولی تولد زنده این گوسفند نقطه عطف علمی مهمی برای كشورمان بود و پایه گذار تلاشهای بیشتر برای تولید حیوانات شبیه سازی شد. نخستین پستاندار شبیه سازی شده ایران و خاورمیانه از طریق انتقال هسته یك سلول بالغ از عضروف گوش یك گوسفند به درون تخمك بدون هسته یك گوسفند دیگر و تكامل آن به دست آمد. با این حساب، ایران به جمع ۸ كشوری ملحق شد كه دارای توانایی شبیه سازی گوسفند هستند.به دنیا آمدن این گوسفند ثمره تلاش چندین ماهه محققان مركز رویان است.

 

   انتقال جنین های شبیه سازی شده گوسفند از اواخر شهریورماه سال گذشته آغاز شد. لازم به ذكر است كه در به ثمر رسیدن این طرح مرحوم دكتر سعید كاظمی آشتیانی زحمات فراوانی را متحمل شد. وی كه به ناگهان در دیماه سال ۸۴ درگذشت، دستیابی به فناوری همانندسازی حیوانات به ویژه در زمینه تكثیر حیوانات تراریخته با صفات ویژه را دارای اهمیت خاصی میدانست. به عقیده وی، این تكنیك در زمینه پزشكی كاربردهای زیادی دارد كه از جمله میتوان به استفاده از حیوانهای شبیه سازی شده برای تولید آنتی بادیهای انسانی قابل استفاده علیه بیماریهای مسری اشاره كرد.

 

   پس از موفقیت اولیه در به دنیا آوردن گوسفند شبیه سازی شده، دانشمندان ما تلاشهای زیادی برای به دنیا آوردن گوسفندی كه قادر به زنده ماندن طولانیمدت باشد، انجام دادند. حاصل این زحمات، به دنیا آمدن دومین گوسفند شبیهسازی شده ایرانی به نام رویانا در بامداد روز شنبه، ۸ مهرماه در پایگاه تحقیقاتی پژوهشكده رویان بود كه این مرتبه زنده ماند. البته دانشمندان ایرانی اظهار داشتهاند كه هنوز راضی نشده و قصد دارند حیوانات دیگری نظیر گاو را نیز همانندسازی كنند. علاوه بر این، پژوهشكده رویان اعلام آمادگی كرده كه نمونههای لازم را جهت بررسیهای بیشتر در اختیار سایر مراكز تحقیقاتی داخل و خارج از كشور قرار دهد.

 

   در شبیه سازی گوسفند دو مبحث وجود دارد؛

 یكی به دست آوردن تكنولوژی شبیه سازی كه دانشمندان ما از نظر علمی آن را كاملا در اختیار دارند و دیگری بارور شدن گوسفند و به دنیا آوردن گوسفند شبیه سازی شده كه اكنون دانشمندان ایرانی براساس قوانین علمی روز دنیا این كار را انجام می دهند.

 

منبع :

روزنامه سلامت

+ نوشته شده در  دوشنبه هفتم آبان 1386ساعت 0:0  توسط زارع زاده  |